ID: 1153410691

View in Genome Browser
Species Human (GRCh38)
Location 18:4789375-4789397
Sequence ACGTGTGTGGTCCACTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153410691_1153410696 28 Left 1153410691 18:4789375-4789397 CCATGATAGTGGACCACACACGT No data
Right 1153410696 18:4789426-4789448 CCCAGTGGACATGCACCAGCTGG No data
1153410691_1153410693 13 Left 1153410691 18:4789375-4789397 CCATGATAGTGGACCACACACGT No data
Right 1153410693 18:4789411-4789433 CTCCAGCAGAGCAATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153410691 Original CRISPR ACGTGTGTGGTCCACTATCA TGG (reversed) Intergenic
No off target data available for this crispr