ID: 1153412351

View in Genome Browser
Species Human (GRCh38)
Location 18:4807935-4807957
Sequence TTTCTTTGTCGCTGCTTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153412351_1153412353 19 Left 1153412351 18:4807935-4807957 CCTGCGAAGCAGCGACAAAGAAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1153412353 18:4807977-4807999 AGAATGATCCCTGATTGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153412351 Original CRISPR TTTCTTTGTCGCTGCTTCGC AGG (reversed) Intergenic
902927368 1:19704994-19705016 TCTCTTTGTCGCTGCTGACCTGG + Intronic
903665662 1:25005979-25006001 TTTGTTTGTCTCTGTTTCTCTGG + Intergenic
908685578 1:66715377-66715399 TTTCTGTGTTTCTGCTTCCCTGG + Intronic
910941965 1:92546259-92546281 TGTCTTTGTCACTGATTAGCTGG - Intronic
914989379 1:152485276-152485298 TTTCCTTGTCCCTGGTTCGAGGG + Intergenic
915194770 1:154181369-154181391 TTTCTTTTTGGCTGCTCCTCTGG - Intronic
915765764 1:158360634-158360656 TTTCTTTGTAGTTCCTTTGCCGG - Intergenic
917378249 1:174374301-174374323 TTTATTTGTCCCTGATTCTCTGG + Intronic
918640592 1:186837037-186837059 TTTCTTAGTTGCTTCTTTGCAGG - Intronic
924774212 1:247104341-247104363 TTGCTTTGTCTCTCCTTCGCCGG - Exonic
924788097 1:247219097-247219119 TTTCCTTGTCCCTGGTTCGAGGG - Intergenic
924804976 1:247354775-247354797 TTTCCTTGTCCCTGGTTCGAGGG - Intergenic
1065809021 10:29424006-29424028 TTGTTTTGTCACTGCTTCCCTGG + Intergenic
1067205805 10:44212000-44212022 TTTCTTTATCTCTACTTCACTGG + Intergenic
1072017950 10:91368195-91368217 TTTCTTTCTTGCTCCTTCCCAGG + Intergenic
1076090329 10:127680094-127680116 TTTTTTTGTGTCTGCTTCACAGG - Intergenic
1083241738 11:61393438-61393460 GTTCTTTGTCGCTGCAAGGCAGG + Intronic
1084025062 11:66442903-66442925 TTTCCTTGTCCCTGGTTCGAGGG + Intronic
1088746851 11:112811181-112811203 TTTCTTTGTCTCTGTTGCCCAGG - Intergenic
1090439675 11:126715038-126715060 TTTCTGTGTGGCTGCATGGCTGG + Intronic
1091338264 11:134789994-134790016 TTTCTTTGTTGCTGCTTTATTGG + Intergenic
1094399920 12:30051497-30051519 TTTCTTTGTGACTGCTTTACTGG - Intergenic
1097824155 12:64157417-64157439 TTTTTTTGTCGCTGCCACACTGG + Exonic
1107360773 13:39615648-39615670 TTTCTTTGTCTCTGCTAAGGTGG - Intergenic
1107911667 13:45111151-45111173 TTTCTTTCTGGTTGCTTCACAGG + Intergenic
1115434089 14:33354126-33354148 TTTGCTTGCCGCTGCTTCTCAGG + Intronic
1121926397 14:97931083-97931105 TTTCTTAGTTTCTGCTTTGCTGG + Intronic
1129367354 15:75064516-75064538 TTTCCTTGTCCCTGGTTCGAGGG - Intronic
1140246275 16:73252821-73252843 TTTCTTTCTCTCTGCTCCACTGG - Intergenic
1149180799 17:53933595-53933617 TTTCTTTGTCGCAGCTTTAGAGG - Intergenic
1150441988 17:65198583-65198605 TTTTTTTGTGGATGCTTCTCCGG - Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150643181 17:66963417-66963439 TTTCTTTGTGGCACCTTCCCTGG - Intergenic
1152254061 17:79227255-79227277 TCTCTGGCTCGCTGCTTCGCTGG - Intronic
1152474744 17:80510666-80510688 TTTTTTTGGCGCTGCCTCGTTGG + Intergenic
1153412351 18:4807935-4807957 TTTCTTTGTCGCTGCTTCGCAGG - Intergenic
1156793888 18:41015889-41015911 TTTCTTTGTTTCTGCTTGTCTGG - Intergenic
1160686915 19:441143-441165 TTTCTGTGTTGCTGTTTCTCAGG + Intronic
1164770858 19:30807832-30807854 TTTCTTTGAGACTGCTTGGCAGG + Intergenic
1166416322 19:42596802-42596824 TTTCTCTGTGGCTGATTCTCTGG + Intronic
1167303618 19:48694615-48694637 TTTCCTTGTCGCTGAATCACAGG + Intergenic
926171018 2:10552654-10552676 CTTCATTGTCACTGCTTGGCTGG - Intergenic
930498219 2:52175902-52175924 TCTCTTTGTCTCTGCTTTCCAGG + Intergenic
933936918 2:87213515-87213537 TTTCTAGGTTGCTGCTTCTCTGG + Intergenic
934637639 2:96005359-96005381 TTTCCATCTCTCTGCTTCGCGGG + Intergenic
936356225 2:111752309-111752331 TTTCTAGGTTGCTGCTTCTCTGG - Intergenic
943197579 2:184774425-184774447 TTTCTTTGTAGATGGTTCTCAGG + Intronic
1169545152 20:6642474-6642496 TTACTTTGTGGCTGCTTCACAGG - Intergenic
1169918117 20:10703992-10704014 TTTCTTTCTTGCTTCTTCTCGGG + Intergenic
1170779427 20:19411046-19411068 TTTCTTAGTCCCTGCTTTCCAGG + Intronic
1171128729 20:22628243-22628265 ATTCTCTGTCACTGCTTTGCTGG - Intergenic
1176666587 21:9693286-9693308 TTTCTTTGTCACTGTGTGGCTGG + Intergenic
1179634824 21:42701920-42701942 TTTCTTTATCACTGGTTTGCAGG + Intronic
1184108114 22:42380303-42380325 TTTCTTCGTCGCTGCTTTTATGG - Intergenic
967503250 3:190223662-190223684 TTTCCTGGTTGCTGCTTCCCTGG + Intergenic
967881306 3:194303712-194303734 GTTCTTTGTCATTCCTTCGCAGG + Intergenic
971701943 4:29989082-29989104 TTTCCATGTTGCTGCTTGGCTGG - Intergenic
971924691 4:32993146-32993168 TTTCTTAGTCTCTTCTTCTCAGG + Intergenic
972224603 4:36997848-36997870 TTTCATTGTCCCTGCTTCTGGGG - Intergenic
978071416 4:104476320-104476342 TTTCCGTGTGACTGCTTCGCAGG - Intronic
982367990 4:154601481-154601503 TTTTTTTGTCTCTGCCTCACTGG + Intergenic
983179732 4:164633531-164633553 TTTGTTTGTCCTTGCTTCTCAGG - Intergenic
984080347 4:175240940-175240962 TTGCTTTGTCTCTGCTTCATAGG - Intergenic
984573116 4:181416982-181417004 TTCCTTTATCTCTGCTTAGCAGG - Intergenic
985980384 5:3457545-3457567 TTTCTTTGTCCCTGCAGCGTGGG - Intergenic
989236254 5:39151615-39151637 TTTCTTGGTCCCTGCTTTGCAGG + Intronic
996616078 5:125442370-125442392 TTTCTTTGTCTCTGCCTCATTGG - Intergenic
997064953 5:130549063-130549085 TTTCCTTGTCCCTGGTTCGTGGG + Intergenic
998648284 5:144089028-144089050 TCTCTCTGTCTCTGCTTCTCAGG + Intergenic
1000063358 5:157675103-157675125 TTTTTTCATCGCTGCTTCACTGG - Exonic
1007388333 6:41534524-41534546 TTTCTTTCTAGCTGCTATGCTGG + Intergenic
1008159954 6:48065027-48065049 TTTCTGTGTCCCTGCTTGTCTGG + Intronic
1012072824 6:94644196-94644218 TTTGCTTGTCTCTGCTTCTCTGG + Intergenic
1015778605 6:136840316-136840338 TTTCTTCCTCGCTTCTTCCCAGG + Intronic
1020739688 7:11998670-11998692 TTACTTTGTCCCTTCTTCACTGG - Intergenic
1024466432 7:49716410-49716432 TATCTTTGTCACTGCTTCTTAGG - Intergenic
1027927719 7:84488480-84488502 TTTTTTTTTCACTGCTTTGCAGG + Intronic
1031326595 7:120407244-120407266 TTTTTTTGTCGCTGTTGAGCAGG + Intronic
1044750437 8:95410757-95410779 TTTCTTGGTCACTCCTTTGCTGG + Intergenic
1046379643 8:113435113-113435135 TTTCTTTGTCGCTGGCTCGACGG - Intronic
1047561019 8:125988230-125988252 TTTCCTTGTCGCTGGTTCAAGGG - Intergenic
1048396648 8:134020308-134020330 TCTCTGTGTAGCTGCTTCACGGG + Intergenic
1051717181 9:19997256-19997278 TTTCTGTGCCCCTGCTTTGCTGG - Intergenic
1052575809 9:30289468-30289490 TCTATTGGTTGCTGCTTCGCAGG + Intergenic
1056992233 9:91423234-91423256 TTTCTTTCTCGTTCCTTCTCTGG - Intronic
1059156748 9:111996215-111996237 TTTTATTGTCGCTGCTTTACAGG - Intergenic
1061018094 9:127994660-127994682 TTTTTTTATCACTGCTTCGCTGG + Intergenic
1203659514 Un_KI270753v1:28475-28497 TTTCTTTGTCACTGTGTGGCTGG - Intergenic
1185814516 X:3142663-3142685 TTCCTGTGTCTCTTCTTCGCAGG - Intergenic
1186446980 X:9638960-9638982 TTCCTTTGTGCCTGCTTCCCTGG + Intronic
1187071792 X:15895866-15895888 TCTCTTTGCTGCTGCTTCTCTGG + Intergenic
1190755829 X:53401077-53401099 TTTTTCTGTCGCTGCCTGGCTGG + Intronic
1195664288 X:107414663-107414685 TTTCTTTGTCAGTGCTTAGGTGG + Intergenic
1199860269 X:151795128-151795150 TTTCTGTGTGGCTGGTTCTCAGG + Intergenic
1201617822 Y:15921149-15921171 TTTCTTTGTCTCTCCTTACCTGG + Intergenic
1201719127 Y:17077931-17077953 TTACTTTGTCTCTGCTGTGCAGG + Intergenic