ID: 1153420962

View in Genome Browser
Species Human (GRCh38)
Location 18:4904648-4904670
Sequence TTTGATTTTCTAAAAAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153420962_1153420967 28 Left 1153420962 18:4904648-4904670 CCAGTCCTTTTTAGAAAATCAAA No data
Right 1153420967 18:4904699-4904721 TTCCTCCTAGCTGTGCCTGCGGG No data
1153420962_1153420966 27 Left 1153420962 18:4904648-4904670 CCAGTCCTTTTTAGAAAATCAAA No data
Right 1153420966 18:4904698-4904720 TTTCCTCCTAGCTGTGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153420962 Original CRISPR TTTGATTTTCTAAAAAGGAC TGG (reversed) Intergenic
No off target data available for this crispr