ID: 1153427549 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:4982712-4982734 |
| Sequence | GGGAATCTAAGTCTCTTTGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 12204 | |||
| Summary | {0: 4, 1: 319, 2: 7057, 3: 3330, 4: 1494} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1153427549_1153427553 | 12 | Left | 1153427549 | 18:4982712-4982734 | CCTGCAAAGAGACTTAGATTCCC | 0: 4 1: 319 2: 7057 3: 3330 4: 1494 |
||
| Right | 1153427553 | 18:4982747-4982769 | GCAAGGCTTTAACAGCCCACTGG | No data | ||||
| 1153427549_1153427550 | -5 | Left | 1153427549 | 18:4982712-4982734 | CCTGCAAAGAGACTTAGATTCCC | 0: 4 1: 319 2: 7057 3: 3330 4: 1494 |
||
| Right | 1153427550 | 18:4982730-4982752 | TTCCCAACAATAATAGTGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1153427549 | Original CRISPR | GGGAATCTAAGTCTCTTTGC AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||