ID: 1153427549

View in Genome Browser
Species Human (GRCh38)
Location 18:4982712-4982734
Sequence GGGAATCTAAGTCTCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12204
Summary {0: 4, 1: 319, 2: 7057, 3: 3330, 4: 1494}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153427549_1153427553 12 Left 1153427549 18:4982712-4982734 CCTGCAAAGAGACTTAGATTCCC 0: 4
1: 319
2: 7057
3: 3330
4: 1494
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data
1153427549_1153427550 -5 Left 1153427549 18:4982712-4982734 CCTGCAAAGAGACTTAGATTCCC 0: 4
1: 319
2: 7057
3: 3330
4: 1494
Right 1153427550 18:4982730-4982752 TTCCCAACAATAATAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153427549 Original CRISPR GGGAATCTAAGTCTCTTTGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr