ID: 1153427550

View in Genome Browser
Species Human (GRCh38)
Location 18:4982730-4982752
Sequence TTCCCAACAATAATAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153427549_1153427550 -5 Left 1153427549 18:4982712-4982734 CCTGCAAAGAGACTTAGATTCCC 0: 4
1: 319
2: 7057
3: 3330
4: 1494
Right 1153427550 18:4982730-4982752 TTCCCAACAATAATAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153427550 Original CRISPR TTCCCAACAATAATAGTGCA AGG Intergenic
No off target data available for this crispr