ID: 1153427551

View in Genome Browser
Species Human (GRCh38)
Location 18:4982732-4982754
Sequence AGCCTTGCACTATTATTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153427551_1153427553 -8 Left 1153427551 18:4982732-4982754 CCCAACAATAATAGTGCAAGGCT No data
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153427551 Original CRISPR AGCCTTGCACTATTATTGTT GGG (reversed) Intergenic
No off target data available for this crispr