ID: 1153427552

View in Genome Browser
Species Human (GRCh38)
Location 18:4982733-4982755
Sequence AAGCCTTGCACTATTATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153427552_1153427553 -9 Left 1153427552 18:4982733-4982755 CCAACAATAATAGTGCAAGGCTT No data
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153427552 Original CRISPR AAGCCTTGCACTATTATTGT TGG (reversed) Intergenic
No off target data available for this crispr