ID: 1153427553

View in Genome Browser
Species Human (GRCh38)
Location 18:4982747-4982769
Sequence GCAAGGCTTTAACAGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153427552_1153427553 -9 Left 1153427552 18:4982733-4982755 CCAACAATAATAGTGCAAGGCTT No data
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data
1153427549_1153427553 12 Left 1153427549 18:4982712-4982734 CCTGCAAAGAGACTTAGATTCCC 0: 4
1: 319
2: 7057
3: 3330
4: 1494
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data
1153427551_1153427553 -8 Left 1153427551 18:4982732-4982754 CCCAACAATAATAGTGCAAGGCT No data
Right 1153427553 18:4982747-4982769 GCAAGGCTTTAACAGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153427553 Original CRISPR GCAAGGCTTTAACAGCCCAC TGG Intergenic
No off target data available for this crispr