ID: 1153431750

View in Genome Browser
Species Human (GRCh38)
Location 18:5025036-5025058
Sequence ATGCACAGGGTTGGGGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153431750_1153431761 12 Left 1153431750 18:5025036-5025058 CCCTAAGCCCCAACCCTGTGCAT No data
Right 1153431761 18:5025071-5025093 TGGTAACTTAGAGCTCACACTGG No data
1153431750_1153431762 13 Left 1153431750 18:5025036-5025058 CCCTAAGCCCCAACCCTGTGCAT No data
Right 1153431762 18:5025072-5025094 GGTAACTTAGAGCTCACACTGGG No data
1153431750_1153431759 -8 Left 1153431750 18:5025036-5025058 CCCTAAGCCCCAACCCTGTGCAT No data
Right 1153431759 18:5025051-5025073 CTGTGCATGCCATGGGACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153431750 Original CRISPR ATGCACAGGGTTGGGGCTTA GGG (reversed) Intergenic
No off target data available for this crispr