ID: 1153431751

View in Genome Browser
Species Human (GRCh38)
Location 18:5025037-5025059
Sequence CATGCACAGGGTTGGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153431751_1153431763 30 Left 1153431751 18:5025037-5025059 CCTAAGCCCCAACCCTGTGCATG No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431751_1153431762 12 Left 1153431751 18:5025037-5025059 CCTAAGCCCCAACCCTGTGCATG No data
Right 1153431762 18:5025072-5025094 GGTAACTTAGAGCTCACACTGGG No data
1153431751_1153431761 11 Left 1153431751 18:5025037-5025059 CCTAAGCCCCAACCCTGTGCATG No data
Right 1153431761 18:5025071-5025093 TGGTAACTTAGAGCTCACACTGG No data
1153431751_1153431759 -9 Left 1153431751 18:5025037-5025059 CCTAAGCCCCAACCCTGTGCATG No data
Right 1153431759 18:5025051-5025073 CTGTGCATGCCATGGGACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153431751 Original CRISPR CATGCACAGGGTTGGGGCTT AGG (reversed) Intergenic
No off target data available for this crispr