ID: 1153431757

View in Genome Browser
Species Human (GRCh38)
Location 18:5025049-5025071
Sequence ATCGTCCCATGGCATGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153431757_1153431763 18 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431757_1153431762 0 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431762 18:5025072-5025094 GGTAACTTAGAGCTCACACTGGG No data
1153431757_1153431765 30 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431765 18:5025102-5025124 TGAAAACACGGGTGCCTGAGAGG No data
1153431757_1153431761 -1 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431761 18:5025071-5025093 TGGTAACTTAGAGCTCACACTGG No data
1153431757_1153431764 19 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431764 18:5025091-5025113 TGGGTCATAAGTGAAAACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153431757 Original CRISPR ATCGTCCCATGGCATGCACA GGG (reversed) Intergenic
No off target data available for this crispr