ID: 1153431763

View in Genome Browser
Species Human (GRCh38)
Location 18:5025090-5025112
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153431758_1153431763 17 Left 1153431758 18:5025050-5025072 CCTGTGCATGCCATGGGACGATG No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431760_1153431763 7 Left 1153431760 18:5025060-5025082 CCATGGGACGATGGTAACTTAGA No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431754_1153431763 23 Left 1153431754 18:5025044-5025066 CCCAACCCTGTGCATGCCATGGG No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431752_1153431763 24 Left 1153431752 18:5025043-5025065 CCCCAACCCTGTGCATGCCATGG No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431756_1153431763 22 Left 1153431756 18:5025045-5025067 CCAACCCTGTGCATGCCATGGGA No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431757_1153431763 18 Left 1153431757 18:5025049-5025071 CCCTGTGCATGCCATGGGACGAT No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data
1153431751_1153431763 30 Left 1153431751 18:5025037-5025059 CCTAAGCCCCAACCCTGTGCATG No data
Right 1153431763 18:5025090-5025112 CTGGGTCATAAGTGAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153431763 Original CRISPR CTGGGTCATAAGTGAAAACA CGG Intergenic
No off target data available for this crispr