ID: 1153434235

View in Genome Browser
Species Human (GRCh38)
Location 18:5051905-5051927
Sequence ACTTCCTTGAGTAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153434232_1153434235 8 Left 1153434232 18:5051874-5051896 CCAAACTAACCAAGCCACACAAA No data
Right 1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG No data
1153434231_1153434235 17 Left 1153434231 18:5051865-5051887 CCATAAATGCCAAACTAACCAAG No data
Right 1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG No data
1153434234_1153434235 -6 Left 1153434234 18:5051888-5051910 CCACACAAACTCTATTTACTTCC No data
Right 1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG No data
1153434233_1153434235 -1 Left 1153434233 18:5051883-5051905 CCAAGCCACACAAACTCTATTTA No data
Right 1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153434235 Original CRISPR ACTTCCTTGAGTAAAATTTC AGG Intergenic
No off target data available for this crispr