ID: 1153434789

View in Genome Browser
Species Human (GRCh38)
Location 18:5057875-5057897
Sequence CTGGAGACCTTGAAATCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153434783_1153434789 17 Left 1153434783 18:5057835-5057857 CCTCTCTTGAGACTCAAGAGACC No data
Right 1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG No data
1153434781_1153434789 25 Left 1153434781 18:5057827-5057849 CCCACTAACCTCTCTTGAGACTC No data
Right 1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG No data
1153434785_1153434789 -4 Left 1153434785 18:5057856-5057878 CCTCACCAGCTGGCTGAGCCTGG No data
Right 1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG No data
1153434787_1153434789 -9 Left 1153434787 18:5057861-5057883 CCAGCTGGCTGAGCCTGGAGACC No data
Right 1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG No data
1153434782_1153434789 24 Left 1153434782 18:5057828-5057850 CCACTAACCTCTCTTGAGACTCA No data
Right 1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153434789 Original CRISPR CTGGAGACCTTGAAATCCAG AGG Intergenic
No off target data available for this crispr