ID: 1153434799

View in Genome Browser
Species Human (GRCh38)
Location 18:5057927-5057949
Sequence ATTTATATCCACAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153434799_1153434804 -2 Left 1153434799 18:5057927-5057949 CCTGCCATCTTGTGGATATAAAT No data
Right 1153434804 18:5057948-5057970 ATGGTAACTACACCGAGGCTGGG No data
1153434799_1153434807 24 Left 1153434799 18:5057927-5057949 CCTGCCATCTTGTGGATATAAAT No data
Right 1153434807 18:5057974-5057996 AAAACCCCCTTAAGGATCAAAGG No data
1153434799_1153434806 16 Left 1153434799 18:5057927-5057949 CCTGCCATCTTGTGGATATAAAT No data
Right 1153434806 18:5057966-5057988 CTGGGCTCAAAACCCCCTTAAGG No data
1153434799_1153434803 -3 Left 1153434799 18:5057927-5057949 CCTGCCATCTTGTGGATATAAAT No data
Right 1153434803 18:5057947-5057969 AATGGTAACTACACCGAGGCTGG No data
1153434799_1153434802 -7 Left 1153434799 18:5057927-5057949 CCTGCCATCTTGTGGATATAAAT No data
Right 1153434802 18:5057943-5057965 TATAAATGGTAACTACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153434799 Original CRISPR ATTTATATCCACAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr