ID: 1153437545

View in Genome Browser
Species Human (GRCh38)
Location 18:5083880-5083902
Sequence GAGGCCCAGCTTAAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153437545_1153437549 -2 Left 1153437545 18:5083880-5083902 CCACAAAACTTAAGCTGGGCCTC No data
Right 1153437549 18:5083901-5083923 TCAAATCTCAGGAATTTTGGAGG No data
1153437545_1153437547 -5 Left 1153437545 18:5083880-5083902 CCACAAAACTTAAGCTGGGCCTC No data
Right 1153437547 18:5083898-5083920 GCCTCAAATCTCAGGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153437545 Original CRISPR GAGGCCCAGCTTAAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr