ID: 1153438710

View in Genome Browser
Species Human (GRCh38)
Location 18:5093419-5093441
Sequence GTGCTATGACAGATGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153438710_1153438714 -7 Left 1153438710 18:5093419-5093441 CCTGGGCCCATCTGTCATAGCAC No data
Right 1153438714 18:5093435-5093457 ATAGCACCTGTCCACATTTTGGG No data
1153438710_1153438713 -8 Left 1153438710 18:5093419-5093441 CCTGGGCCCATCTGTCATAGCAC No data
Right 1153438713 18:5093434-5093456 CATAGCACCTGTCCACATTTTGG No data
1153438710_1153438718 19 Left 1153438710 18:5093419-5093441 CCTGGGCCCATCTGTCATAGCAC No data
Right 1153438718 18:5093461-5093483 CACCACTAATGACATCTTGTTGG No data
1153438710_1153438719 20 Left 1153438710 18:5093419-5093441 CCTGGGCCCATCTGTCATAGCAC No data
Right 1153438719 18:5093462-5093484 ACCACTAATGACATCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153438710 Original CRISPR GTGCTATGACAGATGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr