ID: 1153439526

View in Genome Browser
Species Human (GRCh38)
Location 18:5101232-5101254
Sequence AGTCATATGAAACTACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153439523_1153439526 12 Left 1153439523 18:5101197-5101219 CCTGGTTTTCAGGGTCTTACCAG No data
Right 1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG No data
1153439524_1153439526 -7 Left 1153439524 18:5101216-5101238 CCAGCCGATAGACTCTAGTCATA No data
Right 1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG No data
1153439522_1153439526 18 Left 1153439522 18:5101191-5101213 CCATATCCTGGTTTTCAGGGTCT No data
Right 1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG No data
1153439518_1153439526 28 Left 1153439518 18:5101181-5101203 CCAGCTTGGCCCATATCCTGGTT No data
Right 1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG No data
1153439521_1153439526 19 Left 1153439521 18:5101190-5101212 CCCATATCCTGGTTTTCAGGGTC No data
Right 1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153439526 Original CRISPR AGTCATATGAAACTACTGCC TGG Intergenic
No off target data available for this crispr