ID: 1153440149 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:5108150-5108172 |
Sequence | GTCTACCAATAGAAGTGTCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1153440149_1153440152 | 1 | Left | 1153440149 | 18:5108150-5108172 | CCTGGACACTTCTATTGGTAGAC | No data | ||
Right | 1153440152 | 18:5108174-5108196 | GTATAGCCAGGACCTGGCCAAGG | No data | ||||
1153440149_1153440151 | -5 | Left | 1153440149 | 18:5108150-5108172 | CCTGGACACTTCTATTGGTAGAC | No data | ||
Right | 1153440151 | 18:5108168-5108190 | TAGACAGTATAGCCAGGACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1153440149 | Original CRISPR | GTCTACCAATAGAAGTGTCC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |