ID: 1153440149

View in Genome Browser
Species Human (GRCh38)
Location 18:5108150-5108172
Sequence GTCTACCAATAGAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153440149_1153440152 1 Left 1153440149 18:5108150-5108172 CCTGGACACTTCTATTGGTAGAC No data
Right 1153440152 18:5108174-5108196 GTATAGCCAGGACCTGGCCAAGG No data
1153440149_1153440151 -5 Left 1153440149 18:5108150-5108172 CCTGGACACTTCTATTGGTAGAC No data
Right 1153440151 18:5108168-5108190 TAGACAGTATAGCCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153440149 Original CRISPR GTCTACCAATAGAAGTGTCC AGG (reversed) Intergenic
No off target data available for this crispr