ID: 1153440828

View in Genome Browser
Species Human (GRCh38)
Location 18:5117459-5117481
Sequence ATATGGGGCCCTTTTACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153440828_1153440834 25 Left 1153440828 18:5117459-5117481 CCACAAGTAAAAGGGCCCCATAT No data
Right 1153440834 18:5117507-5117529 GTGCAAGTCCCAAGCCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153440828 Original CRISPR ATATGGGGCCCTTTTACTTG TGG (reversed) Intergenic
No off target data available for this crispr