ID: 1153442837

View in Genome Browser
Species Human (GRCh38)
Location 18:5139941-5139963
Sequence TTCCACTGAAGCTGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153442837_1153442839 -8 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442839 18:5139956-5139978 CAGTGGAAATAAGCTAACAGTGG No data
1153442837_1153442842 12 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442842 18:5139976-5139998 TGGGACACATAAGATGTCAAGGG No data
1153442837_1153442843 25 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442843 18:5139989-5140011 ATGTCAAGGGATTATTCCAGTGG No data
1153442837_1153442840 -7 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data
1153442837_1153442841 11 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442841 18:5139975-5139997 GTGGGACACATAAGATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153442837 Original CRISPR TTCCACTGAAGCTGACCTGG AGG (reversed) Intergenic
No off target data available for this crispr