ID: 1153442838

View in Genome Browser
Species Human (GRCh38)
Location 18:5139944-5139966
Sequence TATTTCCACTGAAGCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153442838_1153442844 28 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442844 18:5139995-5140017 AGGGATTATTCCAGTGGAAAAGG No data
1153442838_1153442843 22 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442843 18:5139989-5140011 ATGTCAAGGGATTATTCCAGTGG No data
1153442838_1153442841 8 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442841 18:5139975-5139997 GTGGGACACATAAGATGTCAAGG No data
1153442838_1153442840 -10 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data
1153442838_1153442842 9 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442842 18:5139976-5139998 TGGGACACATAAGATGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153442838 Original CRISPR TATTTCCACTGAAGCTGACC TGG (reversed) Intergenic
No off target data available for this crispr