ID: 1153442840

View in Genome Browser
Species Human (GRCh38)
Location 18:5139957-5139979
Sequence AGTGGAAATAAGCTAACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153442837_1153442840 -7 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data
1153442833_1153442840 19 Left 1153442833 18:5139915-5139937 CCTAGGTCTTCACATGCAGCAGG No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data
1153442832_1153442840 20 Left 1153442832 18:5139914-5139936 CCCTAGGTCTTCACATGCAGCAG No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data
1153442838_1153442840 -10 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442840 18:5139957-5139979 AGTGGAAATAAGCTAACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153442840 Original CRISPR AGTGGAAATAAGCTAACAGT GGG Intergenic
No off target data available for this crispr