ID: 1153442841

View in Genome Browser
Species Human (GRCh38)
Location 18:5139975-5139997
Sequence GTGGGACACATAAGATGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153442837_1153442841 11 Left 1153442837 18:5139941-5139963 CCTCCAGGTCAGCTTCAGTGGAA No data
Right 1153442841 18:5139975-5139997 GTGGGACACATAAGATGTCAAGG No data
1153442838_1153442841 8 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442841 18:5139975-5139997 GTGGGACACATAAGATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153442841 Original CRISPR GTGGGACACATAAGATGTCA AGG Intergenic
No off target data available for this crispr