ID: 1153442844

View in Genome Browser
Species Human (GRCh38)
Location 18:5139995-5140017
Sequence AGGGATTATTCCAGTGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153442838_1153442844 28 Left 1153442838 18:5139944-5139966 CCAGGTCAGCTTCAGTGGAAATA No data
Right 1153442844 18:5139995-5140017 AGGGATTATTCCAGTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153442844 Original CRISPR AGGGATTATTCCAGTGGAAA AGG Intergenic
No off target data available for this crispr