ID: 1153442844 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:5139995-5140017 |
| Sequence | AGGGATTATTCCAGTGGAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1153442838_1153442844 | 28 | Left | 1153442838 | 18:5139944-5139966 | CCAGGTCAGCTTCAGTGGAAATA | No data | ||
| Right | 1153442844 | 18:5139995-5140017 | AGGGATTATTCCAGTGGAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1153442844 | Original CRISPR | AGGGATTATTCCAGTGGAAA AGG | Intergenic | ||