ID: 1153444386

View in Genome Browser
Species Human (GRCh38)
Location 18:5155292-5155314
Sequence GGGGCTGAAAACTCCACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 24, 3: 27, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153444380_1153444386 2 Left 1153444380 18:5155267-5155289 CCTGTGCTTCATCTTTTGATGTC 0: 1
1: 2
2: 50
3: 91
4: 306
Right 1153444386 18:5155292-5155314 GGGGCTGAAAACTCCACTCTGGG 0: 1
1: 1
2: 24
3: 27
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153444386 Original CRISPR GGGGCTGAAAACTCCACTCT GGG Intronic
900173702 1:1282573-1282595 GGGGCTGAAGACGCCAGCCTGGG + Intronic
912606316 1:110993041-110993063 AGGGCTGAATAGTCCACTCTAGG + Intergenic
913370805 1:118096843-118096865 GGGCCAGTAAACCCCACTCTTGG + Intronic
913705981 1:121423519-121423541 AGGGCCGAAAACTCTACCCTCGG - Intergenic
915002417 1:152605436-152605458 GCAGCTGAATACTACACTCTGGG - Intergenic
915302571 1:154959725-154959747 GGGGCTGCAACCCCCACTTTGGG + Exonic
915611099 1:156993658-156993680 CCTGCTGAAAACTCCACCCTGGG - Intronic
916420700 1:164635227-164635249 GGGACTGAGAGCTCCTCTCTTGG - Intronic
922231312 1:223689265-223689287 AGGGCCAAAAACTCCACCCTTGG - Intergenic
923680295 1:236113338-236113360 GGTCCTGAACACTCCACTGTGGG - Intergenic
923842150 1:237684535-237684557 GGTGCTGAAATTTCAACTCTGGG + Intronic
924957226 1:248941178-248941200 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1064674534 10:17748061-17748083 CGGGCTGGAACCTCCACTCCTGG - Intergenic
1064879980 10:20040365-20040387 AGGGCCCAAAACTCCACCCTTGG + Intronic
1065861053 10:29872745-29872767 GGGGGTGAAAAAACCACCCTGGG - Intergenic
1070493047 10:76995359-76995381 GGCGCTGCAAACTCCACACTGGG + Intronic
1071188518 10:83073630-83073652 AGGGCTGAATACTCCACCCTTGG + Intergenic
1073105225 10:101029003-101029025 GGGCCTGAACAGTCCAGTCTGGG + Intronic
1073434486 10:103507969-103507991 GGGGCTTTGATCTCCACTCTGGG - Intronic
1074528573 10:114281266-114281288 GGGGCAGAAAGCCCCACTCTGGG - Intronic
1074928847 10:118103050-118103072 GGAGCAGAAAACTCAGCTCTGGG + Intergenic
1075105599 10:119538282-119538304 GGGGCAGAGAACTCAAGTCTTGG - Intronic
1075288968 10:121212107-121212129 GAGGCTGAAAACACAGCTCTAGG - Intergenic
1076230889 10:128819196-128819218 GGCTCTGCAGACTCCACTCTGGG + Intergenic
1076861909 10:133141751-133141773 GGGGCTCAAATCCCCACACTGGG + Intergenic
1076963133 10:133783022-133783044 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1077767533 11:5177083-5177105 GGGTCTAAAATCTCCACTATAGG + Intronic
1079443436 11:20537855-20537877 GGGGAAGAAAAGTACACTCTAGG + Intergenic
1084964316 11:72736485-72736507 GGGGCTTAAACCTCCAAACTAGG - Intronic
1085236206 11:75017469-75017491 AGGGCTGGGAGCTCCACTCTTGG - Intronic
1087634819 11:100690068-100690090 GGGGCTGACCATTCCACTGTGGG + Intronic
1090076373 11:123582328-123582350 GGACCTGAAAACTCGCCTCTAGG - Intronic
1090206652 11:124887870-124887892 GGGTCTGAAAAGTCCATCCTGGG - Intronic
1090970245 11:131636195-131636217 AGGACTGAACACTCCAGTCTCGG + Intronic
1091085897 11:132721522-132721544 AGGGCTGCAAACTCATCTCTGGG + Intronic
1091789051 12:3260823-3260845 GGGGCTGATGCCTCTACTCTGGG - Intronic
1092923045 12:13249404-13249426 AGGCCTGAAAACTCCACTCTTGG + Intergenic
1104408307 12:128537132-128537154 AGGGCTGAAAACCCCACCTTGGG - Intronic
1105074387 12:133262723-133262745 AGGGCTGAAAACTCCACCATGGG - Intergenic
1108870890 13:54984282-54984304 GTGGCTGAAAACTCCAGAATAGG - Intergenic
1110638789 13:77797439-77797461 GGGGCTGAAAAATTAACTATTGG + Intergenic
1113989558 13:114349859-114349881 ATAGCTGAAAACTCCACCCTGGG - Intergenic
1116523297 14:45874595-45874617 CAGGGTGAAAACTCCACCCTTGG + Intergenic
1119752716 14:77091631-77091653 AGGGCCAAAAACTCTACTCTTGG - Intergenic
1122619410 14:103046235-103046257 GAGACTGGAAACTCCTCTCTAGG + Intronic
1124100615 15:26689598-26689620 AGGGCTGAAAACTCCACTCTGGG - Intronic
1124317635 15:28684714-28684736 GGGACTGAAAACTCCAAGATGGG - Intergenic
1124565810 15:30812796-30812818 GGGACTGAAAACTCCAAGATGGG + Intergenic
1125519974 15:40343124-40343146 GAGGCTGAAAAAGCCAGTCTTGG - Intergenic
1130597332 15:85256943-85256965 GTGGCAGAAAACTCCTCACTTGG + Intergenic
1130695030 15:86122704-86122726 GGGGCTTAAAATTTCACTTTTGG - Intergenic
1132183091 15:99777140-99777162 TGGCCTGAAAACTCCATTCATGG + Intergenic
1132465700 16:76528-76550 GGGGATAAAAACACCCCTCTGGG + Intergenic
1132602146 16:778184-778206 TGGGCTGTAAAATCCGCTCTGGG + Intronic
1132652789 16:1029095-1029117 GGGGCTGGGGGCTCCACTCTGGG - Intergenic
1135202201 16:20447202-20447224 TGGTCTGAAAACACCTCTCTGGG - Intergenic
1135216903 16:20580664-20580686 TGGTCTGAAAACACCTCTCTGGG + Intergenic
1136092150 16:27928273-27928295 AGGGCTGGAATCTACACTCTGGG - Intronic
1136407636 16:30057768-30057790 GGTTCTGAAAACTCCTGTCTTGG + Intronic
1137494741 16:48961145-48961167 AGGGTCGAAAACTCCACCCTTGG - Intergenic
1138236634 16:55389079-55389101 GGGACTGGATACTGCACTCTGGG - Intergenic
1138717643 16:59042624-59042646 AGGGCTGAAAACTCCACCCTTGG + Intergenic
1144016650 17:11202588-11202610 TTGTCTGAGAACTCCACTCTGGG - Intergenic
1144872437 17:18379457-18379479 GGAGCTGCACACTCCACCCTGGG - Intronic
1146530863 17:33606815-33606837 GGGGCTGAGAACTCCAACCCAGG + Intronic
1147919033 17:43905457-43905479 GGGGCTGTAGACTCCATGCTTGG - Intronic
1148186619 17:45649172-45649194 GAGGCTGCCAGCTCCACTCTTGG + Intergenic
1149036044 17:52135401-52135423 AGAGCTCAAAACTCCACCCTTGG + Intronic
1151748825 17:76025565-76025587 GGAGCTGCACACTCCACCCTGGG + Intronic
1152448788 17:80363352-80363374 GGTGCTTCCAACTCCACTCTGGG + Intronic
1152952274 17:83245249-83245271 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1153444386 18:5155292-5155314 GGGGCTGAAAACTCCACTCTGGG + Intronic
1156661494 18:39351270-39351292 AGGGCTGAAAACTCCACCCTGGG + Intergenic
1160653867 19:250237-250259 AGGGCTGAAAACTCCACCCTGGG + Intergenic
1160712565 19:559232-559254 GGGGCTGAGGGCTTCACTCTGGG - Intergenic
1163795318 19:19334577-19334599 TGGTCTGAAAACTCCCATCTGGG + Intronic
1165462872 19:35954317-35954339 GAGACTGAAAACTTCTCTCTCGG + Intergenic
1166217674 19:41346381-41346403 GGGGCTGGATAGTCCACTCCAGG + Intronic
1167236414 19:48318645-48318667 GGGGCTGAAGACTGGACTCCTGG - Intronic
1168416241 19:56170687-56170709 GAGGCTGAAAATCCCACTATTGG - Intergenic
1168692029 19:58383064-58383086 GGTGCTTCAAACTCCACTCCAGG - Intergenic
1168728264 19:58603472-58603494 AGGGCTGAAAACTCCACCCTGGG - Intergenic
928356398 2:30620230-30620252 GGGGCTGGAAAGGCCACACTGGG - Intronic
928719308 2:34100860-34100882 GGTGCTGGAAACTTCAATCTGGG - Intergenic
930274631 2:49297116-49297138 GGGCCTGATAACTCTACTGTGGG + Intergenic
931757115 2:65384207-65384229 GAGGCTGATAACACCACGCTGGG - Intronic
933810067 2:86027592-86027614 GGGGCTGAACACTGAAGTCTCGG + Intronic
935078048 2:99765304-99765326 GGGGGTGAAAATTACATTCTTGG + Intronic
936570289 2:113607538-113607560 AGGGCTGAAAACTCCACCCTGGG + Intergenic
937511528 2:122600299-122600321 GTGGCTTAAAGCTCCACTCCAGG - Intergenic
938848785 2:135238898-135238920 GGGGCTGAAAACTTCTCTGAAGG - Intronic
940837486 2:158539645-158539667 GGCACTGAAAACTTCACTGTGGG - Intronic
941486285 2:166086385-166086407 AGGGCCGAAAACTCTACCCTCGG + Intronic
943050869 2:182911311-182911333 AGGGCTGAAAATCCCACCCTTGG + Intronic
943614959 2:190082128-190082150 AGGGCTGAAAACTCCACCCTTGG + Intronic
945768852 2:214015125-214015147 GCGGCTGAAAACTCCAGCCTTGG - Intronic
946286557 2:218708138-218708160 AGGGCTGAAAACTCCACCCTAGG - Intergenic
947332888 2:229048550-229048572 GGTTCTTAAAACTCCACTCAGGG + Intronic
947632269 2:231662024-231662046 GGGGGTGAAAATTCCCCTCCGGG - Intergenic
948868065 2:240785288-240785310 GGGGCTGAGGACGCCACTGTGGG - Intronic
949088525 2:242179113-242179135 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1171139297 20:22727421-22727443 GGGGGTGAAAACTCCTCTCCAGG - Intergenic
1174274117 20:49391176-49391198 GAGACTGAAAACCCCACTCTGGG + Intronic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1176024685 20:62979745-62979767 GGGGCAGGAAACTCCACTCTGGG - Intergenic
1176277748 20:64282742-64282764 AGGGCTGAAAACTCCACCCTGGG - Intronic
1177491507 21:21831339-21831361 GGAGTTGAAAACTGCAGTCTAGG + Intergenic
1178135745 21:29625478-29625500 GGGGAAGAACACTCCACTCTTGG - Intronic
1178197251 21:30360797-30360819 GGAGCTGCAAACTTCATTCTGGG - Intronic
1178353326 21:31889020-31889042 GGGGCTGAAAAATCTACTGGAGG + Intronic
1178551389 21:33542602-33542624 GGGGCTGAAAAATTCTCTCCCGG + Exonic
1179985298 21:44917657-44917679 GGGGCTGAGAGCTGCACTCCAGG + Intronic
1180263688 21:46695074-46695096 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1182609277 22:31533039-31533061 AGGGCCAAAAACTCCACCCTTGG - Intronic
1183831176 22:40419020-40419042 GGCGATGAAAACTCCACCCCCGG - Exonic
1183875729 22:40779090-40779112 GTTGCTAACAACTCCACTCTGGG - Exonic
1184895954 22:47406571-47406593 GTGGCCGAAAACTCCACCCTCGG + Intergenic
1185160849 22:49228896-49228918 GGGTCAGAAAACCTCACTCTCGG + Intergenic
1185429918 22:50803434-50803456 AGGGCTGAAAACTCCACCCTGGG - Intergenic
950227095 3:11244790-11244812 CGAGCTGAAAGCTGCACTCTTGG + Intronic
951776562 3:26316805-26316827 AAGGCTGAAAACTCCACCCTTGG - Intergenic
952262996 3:31758680-31758702 AGGGCTGAAAACTCCACCCCTGG + Intronic
952508035 3:34025295-34025317 GGCAGTGAATACTCCACTCTGGG + Intergenic
953865446 3:46579530-46579552 GGGGAGGAAAACTGCACTCTAGG - Intronic
954173109 3:48821234-48821256 GGGGCAGAAACTTCAACTCTAGG + Intronic
955171824 3:56573589-56573611 AGGGCTGAAAACTCTACCCTTGG - Intronic
955352764 3:58206216-58206238 CCTGCTGATAACTCCACTCTGGG + Intronic
955820622 3:62891991-62892013 GGGGTTGGAAACACAACTCTGGG + Intergenic
955950177 3:64235892-64235914 TGTGATGGAAACTCCACTCTGGG - Intronic
958672902 3:97227780-97227802 AGGGCTGAAAACTCCACCCTTGG - Intronic
960183063 3:114605920-114605942 GGGCCTGAAAACTCATTTCTTGG - Intronic
962049273 3:131795692-131795714 AGGGCTGAAAACACCACCCTCGG + Intronic
964728308 3:159838085-159838107 GGCCCTGAAAACTCAACTCCTGG - Intronic
965706566 3:171514115-171514137 GGGGTTGAGAACTCCAGGCTGGG - Intergenic
968347022 3:198017170-198017192 GGGTCAGCAAACTCAACTCTTGG - Intronic
970525451 4:16927520-16927542 GGTGCTGAACACTGCACTCCAGG + Intergenic
971415783 4:26427505-26427527 AGGGCTGAGAACTCAGCTCTGGG + Intronic
973134223 4:46686078-46686100 GTGGCTGAACACTCCAAGCTAGG - Intergenic
973572325 4:52253103-52253125 ACAGCTGAAAACTCCACGCTGGG - Intergenic
973925230 4:55730087-55730109 AGGGCTGAAAACTCCTCCCTGGG + Intergenic
974014383 4:56635480-56635502 AGGACTGAAAATTCCATTCTTGG + Intergenic
974896074 4:67940737-67940759 ATGGCTGAAAACTCCACCCTTGG + Intronic
976554184 4:86431863-86431885 AGGGCTGAAAACTCCACCCTCGG - Intronic
977721100 4:100241405-100241427 AGGGCTGAAAACTCCACGCTTGG - Intergenic
978223330 4:106303894-106303916 AGGGCCAAAAACTCCACCCTCGG + Intronic
980402877 4:132315730-132315752 AGGACAGAAAACTCCACACTTGG - Intergenic
980712754 4:136591522-136591544 GGGGCTGAAAATTCCAGGCCTGG + Intergenic
985466354 4:190200320-190200342 AGGGCTGAAAACTCCACCCTGGG - Intergenic
986691794 5:10319403-10319425 AGGCCTGAAAACTCCACCCTCGG - Intergenic
987203369 5:15600118-15600140 ATGGCTGAAAACACCACCCTTGG - Intronic
988705025 5:33717310-33717332 GAGGCTGGAAAGTCAACTCTGGG - Intronic
989016352 5:36939299-36939321 GGGGCTGAAAACTCCCAAGTGGG - Intronic
989972040 5:50536241-50536263 AGGGCTGAAAACTCTACCCTCGG + Intergenic
990371920 5:55128585-55128607 GATTCTGAAAACTCCAATCTAGG + Exonic
991950987 5:71946626-71946648 TGGGCTGAAGTCTCCACCCTGGG - Intergenic
992128474 5:73666933-73666955 AGGGCCAAAAACTCCACCCTTGG - Intronic
992468375 5:77029769-77029791 AGGGCTGAAAACTTCACACTGGG + Intronic
993245880 5:85452489-85452511 AAGGCTGAAAACTCCACCCTTGG - Intergenic
994196709 5:96930313-96930335 AGGACTGAAAACTCCACCCTCGG + Intronic
998035025 5:138907930-138907952 GGGGATGAAAACTCCTCTAATGG - Intronic
999763955 5:154724067-154724089 AGGGCTGGACACTCCACTCCTGG - Intronic
1000516245 5:162238971-162238993 AGGGCAGAAAACACCCCTCTGGG + Intergenic
1001323767 5:170704550-170704572 GGCGCTGAAGAGTCCACGCTAGG - Intronic
1002746305 5:181476651-181476673 AGGGCTGAAAACTCCACCCTGGG - Intergenic
1002925542 6:1604210-1604232 GTGGCTGAAAGCCCCAGTCTCGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1009455854 6:63854995-63855017 GAGTCTGTATACTCCACTCTGGG + Intronic
1011230649 6:85157972-85157994 AAGGCAGAAAACTCCACTCAGGG + Intergenic
1011510040 6:88090071-88090093 AGTGCAGAAAACTCCACACTTGG + Intergenic
1012900139 6:104995507-104995529 GGGTCTGAGAACTCAAGTCTAGG + Intronic
1013554602 6:111243136-111243158 AGGGCCAAAAACTCCACCCTTGG - Intergenic
1016455183 6:144223244-144223266 AGGGCTGAAAACTGCATTCTGGG + Intergenic
1017354234 6:153483225-153483247 AGAGCTGAAAACTTCACCCTTGG + Intergenic
1017642731 6:156510061-156510083 GAGGCTGGAAACTCCAATATCGG - Intergenic
1018892090 6:167989760-167989782 CGGGCAGGAAGCTCCACTCTGGG - Intergenic
1019235177 6:170605940-170605962 GGGGCTGAAAACTCCATCCTGGG - Intergenic
1019424660 7:968610-968632 CGGGCTGAGAACTCCGCTCAGGG + Exonic
1020688845 7:11329718-11329740 GCAGCTGAGAACTTCACTCTAGG - Intergenic
1023744367 7:43309155-43309177 GGAGCAGAAAGTTCCACTCTTGG + Intronic
1024247106 7:47479083-47479105 GAGACTGAAGACTCCTCTCTGGG + Intronic
1026793450 7:73350218-73350240 GGGGATGACACTTCCACTCTGGG - Intronic
1029332649 7:99872319-99872341 GGAGCTGATATCCCCACTCTTGG + Intergenic
1029714592 7:102319034-102319056 GGGGCAGTCATCTCCACTCTGGG - Intronic
1032762818 7:134960328-134960350 TGGGCTGAAATGTCCACCCTTGG + Intronic
1034344913 7:150379949-150379971 GTGGCGGAGAACTCCTCTCTAGG + Intronic
1034530500 7:151693377-151693399 AGGCCTGCAAACTCCTCTCTGGG - Intronic
1035232929 7:157477144-157477166 AGGGCTGGAAACTCCACCCTCGG + Intergenic
1035370954 7:158378582-158378604 TATGCTGAAAACCCCACTCTTGG + Intronic
1035496678 7:159333746-159333768 AGGGCTGAAAACTCCACCATGGG - Intergenic
1035513399 8:210027-210049 AGGGCTGAAAACTCCACCCTGGG + Intergenic
1036573685 8:10004311-10004333 GGAGATAAATACTCCACTCTGGG - Intergenic
1040434590 8:47378095-47378117 AGTGCTGGAAACCCCACTCTTGG - Intronic
1042860584 8:73309225-73309247 GGCTGTGAAAACTCCACCCTGGG - Intronic
1042916121 8:73878095-73878117 GGGGCTGAGGACTCGGCTCTCGG + Intronic
1042940188 8:74099547-74099569 AGGGCCTAAAACTCCACCCTGGG + Intergenic
1046373692 8:113347452-113347474 AAGGCTGTAACCTCCACTCTTGG - Intronic
1047179361 8:122572499-122572521 TGGTCTGAAAACTCCGCTGTTGG + Intergenic
1048593057 8:135839217-135839239 GGGTCTGAAACATCCATTCTAGG - Intergenic
1048841114 8:138567086-138567108 AGGACTGAAAGCTCCACGCTGGG + Intergenic
1049593340 8:143472463-143472485 GGGGCTGCACACTCCTCCCTGGG - Intronic
1049924773 9:398202-398224 GGGTCTAAAATCTCCAGTCTTGG - Intronic
1052026768 9:23582233-23582255 CGAGCTCAAAACTCCACCCTTGG + Intergenic
1052751682 9:32498231-32498253 AGGGCCAAAAACTCCACCCTTGG + Intronic
1055329710 9:75171194-75171216 AGGGCTGAAAACTCCACCCTTGG + Intergenic
1056127390 9:83549069-83549091 AGGGCAGAAAACACAACTCTTGG - Intergenic
1056597653 9:88020945-88020967 GGGGTTGAAAAATTCACTATTGG - Intergenic
1056780171 9:89543254-89543276 GGGCGTGACAGCTCCACTCTGGG - Intergenic
1056814445 9:89791480-89791502 GGGGCTTAATACTCCTCTCAGGG + Intergenic
1056982881 9:91332843-91332865 AGGGCTGAAAACTCTGCCCTCGG - Intronic
1057256027 9:93547789-93547811 GCGGCTGAGAACTTAACTCTTGG - Intronic
1057376379 9:94526976-94526998 GGGTCAGCAAACTCAACTCTTGG - Intergenic
1059193481 9:112348878-112348900 AGGGCAGCAAACTCCACTCACGG + Intergenic
1061884077 9:133582849-133582871 GTGGCTGAAAACCCCACCCGTGG - Intronic
1187080313 X:15979382-15979404 GGTCCTGAAAGCTCCATTCTTGG + Intergenic
1189736479 X:44074705-44074727 AGGGCTGAAAACTCCATGTTGGG + Intergenic
1196534371 X:116824809-116824831 AGGGCTGAAAACTCTACCCTTGG - Intergenic