ID: 1153446436

View in Genome Browser
Species Human (GRCh38)
Location 18:5178187-5178209
Sequence ATGCATATCAATAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153446436_1153446440 -4 Left 1153446436 18:5178187-5178209 CCCTCCTGCTTATTGATATGCAT 0: 1
1: 0
2: 0
3: 8
4: 164
Right 1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG 0: 1
1: 0
2: 0
3: 13
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153446436 Original CRISPR ATGCATATCAATAAGCAGGA GGG (reversed) Intronic
904780032 1:32939472-32939494 ATGCATAATAATAAGTAGGCAGG - Intronic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
909242156 1:73227597-73227619 ATGTATATCAATCAGCATGATGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
913477539 1:119252887-119252909 ATGCTTCTCAACAAGCAGGCCGG + Intergenic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
920100075 1:203511783-203511805 CTGTTTACCAATAAGCAGGAAGG - Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
923794228 1:237137657-237137679 ATCCATTTGAATAAGTAGGAAGG + Intronic
924167923 1:241304562-241304584 AAGCAAATCACTCAGCAGGAGGG + Intronic
1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG + Intronic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1078611981 11:12828771-12828793 ATGCAAATCAATAAGAAACAAGG - Intronic
1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG + Intronic
1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG + Intergenic
1085825638 11:79844192-79844214 ATGTATATCAGAAGGCAGGAGGG - Intergenic
1087317582 11:96622121-96622143 AAGCATGTCTATAACCAGGAAGG - Intergenic
1087375174 11:97330649-97330671 ATACATATCAAAAAGCAAAAAGG - Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088162233 11:106886269-106886291 ATGCATTCCAATTAACAGGAAGG - Intronic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1093316802 12:17662451-17662473 ATGCATATCCAAAAATAGGAAGG - Intergenic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1094478129 12:30858027-30858049 ATGCACATCAAAAAGCATGCAGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1101155233 12:101921342-101921364 ATGCATCCCAATAATCAGGGTGG - Exonic
1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG + Intronic
1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG + Intergenic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1110329418 13:74254090-74254112 ATGCATATAATTATGCATGAAGG - Intergenic
1111544303 13:89710399-89710421 ATTCACATCAATACTCAGGAAGG - Intergenic
1112052839 13:95661188-95661210 ATGCATATCTATAACCACCAGGG - Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1118866112 14:69704905-69704927 ATGCAAAGCAATAAGCACAATGG - Intronic
1119153086 14:72383549-72383571 ATGCCTGTTAATAAGCAGAATGG - Intronic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1126949678 15:53867715-53867737 AATCATATTAATAGGCAGGAAGG - Intergenic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1131318589 15:91364670-91364692 TTCCATATCAATAAGCATCAAGG + Intergenic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1138518582 16:57555763-57555785 AACCATATCAATAAGTAAGAGGG - Intronic
1141855035 16:86674895-86674917 ATGGATGTTAATGAGCAGGAAGG - Intergenic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1146582760 17:34053763-34053785 CTGCATATGATTAAGCAGGTGGG - Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1155736257 18:29226330-29226352 ATGCAGATCAACAATCAGGTGGG + Intergenic
1158117013 18:54006449-54006471 ATGCACATCCATAAGCATCATGG + Intergenic
1159496650 18:69216198-69216220 TTCCATTTCAATAAGAAGGAAGG - Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927292891 2:21422115-21422137 ATGCATAGCCTTAAGCAGGAAGG + Intergenic
928143095 2:28747874-28747896 ATCCATTTCAGTGAGCAGGATGG + Intergenic
928622333 2:33103771-33103793 ATGCTACTCAACAAGCAGGATGG - Intronic
929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG + Intergenic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
932113727 2:69025435-69025457 CTGCATATCATTAAGCATCAGGG - Intronic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
935084427 2:99830814-99830836 ATGCACAACAATAAACAGCATGG - Intronic
935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG + Intronic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
1169553263 20:6723244-6723266 ATGCCTATTTATAAGCAGGAAGG - Intergenic
1174676366 20:52360793-52360815 ATGCATACCAAAAAATAGGATGG - Intergenic
1177510425 21:22079890-22079912 GTGCATATCAGAGAGCAGGAAGG - Intergenic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1181380015 22:22494687-22494709 ATGCATAGAAATAATCTGGAAGG - Intronic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1183773226 22:39944872-39944894 ATTCACCTTAATAAGCAGGATGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG + Intergenic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
951641146 3:24836951-24836973 ATGTCCATCAATAAACAGGAAGG + Intergenic
952946624 3:38482262-38482284 ATACATGTCAATGCGCAGGAAGG - Exonic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG + Intronic
958754741 3:98237516-98237538 ATGCATATCAATCACCTTGAGGG + Intergenic
959143672 3:102517523-102517545 ACGCAAATCAATAAGAAGAAAGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
960396070 3:117139071-117139093 ATGGTTATCTATAGGCAGGAGGG + Intronic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
963196308 3:142534234-142534256 ATGCACATCTATAGTCAGGAAGG + Intronic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968319667 3:197754231-197754253 ATGTATCTCAATAAGCATAAAGG - Intronic
969266321 4:6066444-6066466 ATGCATATTAAAAAGCAAGGAGG - Intronic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971617771 4:28814397-28814419 ATGAATATCTAGAAGCAGGCTGG + Intergenic
971643064 4:29160050-29160072 ATGCATAGCAGTAAGCATAAAGG - Intergenic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
976727086 4:88225312-88225334 ATTTATAAAAATAAGCAGGAAGG + Intronic
977685456 4:99842426-99842448 GTGCATATCCATCAGCACGAGGG - Intronic
979546461 4:121945668-121945690 AACCATATCAATTAGCAGGTGGG - Intronic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
984854569 4:184183707-184183729 ATGCATATCAATAAGTCACATGG + Intronic
985804994 5:2037043-2037065 ATGTGTACCAATAAGCAAGAAGG + Intergenic
986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG + Intergenic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG + Intronic
989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG + Intergenic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
992315021 5:75543697-75543719 TTAGGTATCAATAAGCAGGAAGG + Intronic
992796212 5:80256655-80256677 AAACATATCAATATTCAGGAAGG - Intergenic
994009152 5:94879463-94879485 ATGATTATCAATTAGGAGGAGGG - Intronic
997005138 5:129807553-129807575 ATGCATATCATTAAGCACAGAGG + Intergenic
997049387 5:130361730-130361752 CTGCATATCAATAAACAAAAAGG - Intergenic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG + Intronic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG + Intronic
1004518241 6:16338904-16338926 ATGCACACCAACAAGAAGGAAGG + Intronic
1006641696 6:35492613-35492635 AAGCACATTAATAAGCAGGGCGG - Intronic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG + Intergenic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1024001564 7:45193104-45193126 AACCATATCAACAATCAGGATGG + Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024357402 7:48428236-48428258 ATGCAAATCCATTACCAGGAGGG - Intronic
1024895418 7:54255455-54255477 ATGAATATAAATATCCAGGATGG - Intergenic
1026425223 7:70284900-70284922 CTGCATCTCAGAAAGCAGGAAGG - Intronic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1030230315 7:107201821-107201843 ATACAGATTAATAAGCAGTAAGG - Exonic
1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG + Intergenic
1038113572 8:24527532-24527554 ATGCATTTTAATAAGCATAATGG - Intergenic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1041697459 8:60751270-60751292 ATGCATATTAATAAAAATGAAGG - Intronic
1042012372 8:64261681-64261703 ATGCATTTTTATAAGCAAGAAGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1043820967 8:84863698-84863720 ATGCAGTTCAAAATGCAGGAAGG + Intronic
1055550340 9:77427091-77427113 ATACATATCTACAACCAGGAGGG + Intronic
1058035876 9:100252101-100252123 ATACATATGAATAGGAAGGAAGG + Intronic
1060346522 9:122821660-122821682 TTGCAGATAAATCAGCAGGACGG + Intronic
1186017089 X:5209610-5209632 CTTCATATCAATAAGCAAGCAGG + Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG + Exonic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1188846843 X:35083535-35083557 AAGCATATCGTTAAGCAGCAAGG + Intergenic
1192815097 X:74582127-74582149 TTGCATACCAATAAGCTGGCTGG + Intergenic
1195056282 X:101148608-101148630 ATTGATATCAATATGCAGGCAGG + Intronic
1196293749 X:113976299-113976321 AGGCATATTAATAGGAAGGAAGG - Intergenic
1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG + Intergenic
1196670561 X:118362515-118362537 ATGCTCAGCAAAAAGCAGGAAGG - Intronic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic