ID: 1153446440

View in Genome Browser
Species Human (GRCh38)
Location 18:5178206-5178228
Sequence GCATGGTTTTGTGCATGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153446439_1153446440 -8 Left 1153446439 18:5178191-5178213 CCTGCTTATTGATATGCATGGTT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG 0: 1
1: 0
2: 0
3: 13
4: 273
1153446437_1153446440 -5 Left 1153446437 18:5178188-5178210 CCTCCTGCTTATTGATATGCATG 0: 1
1: 0
2: 0
3: 3
4: 135
Right 1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG 0: 1
1: 0
2: 0
3: 13
4: 273
1153446436_1153446440 -4 Left 1153446436 18:5178187-5178209 CCCTCCTGCTTATTGATATGCAT 0: 1
1: 0
2: 0
3: 8
4: 164
Right 1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG 0: 1
1: 0
2: 0
3: 13
4: 273
1153446435_1153446440 12 Left 1153446435 18:5178171-5178193 CCTAAGGACAGACAGACCCTCCT 0: 1
1: 0
2: 2
3: 24
4: 242
Right 1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG 0: 1
1: 0
2: 0
3: 13
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153446440 Original CRISPR GCATGGTTTTGTGCATGCTA TGG Intronic
900576408 1:3384694-3384716 GCATGTGTGTGTGCATGCTCAGG - Intronic
901468698 1:9440734-9440756 GCTTGGTTTAGTGCCTGCTACGG - Intergenic
902083095 1:13834667-13834689 GCTTGGTTTTGTACATTTTAGGG + Intergenic
902424913 1:16312616-16312638 GCTTGGTGTTGTGCATTCTATGG - Intronic
906287278 1:44595486-44595508 GCAGGGTTGTGTGCAGGCTGGGG + Intronic
909274040 1:73662070-73662092 TCTTGGTTTTGTACATTCTATGG + Intergenic
910570325 1:88694161-88694183 TCTTGGTGTTGTGCATTCTATGG + Intronic
910577184 1:88778146-88778168 GCTTGGTTTTGTACATTTTAGGG - Intronic
910640942 1:89461310-89461332 CCTTGGTGTTGTGCATTCTATGG - Intergenic
911723374 1:101215462-101215484 TCTTGGTGTTGTGCATTCTATGG - Intergenic
913365937 1:118038872-118038894 CCTTGGTGTTGTGCATTCTAAGG - Intronic
913587519 1:120290171-120290193 GCTTGGTTTTGTACATTCTAGGG + Intergenic
913620666 1:120608198-120608220 GCTTGGTTTTGTACATTCTAGGG - Intergenic
914358215 1:146907134-146907156 GCTTGGTTTTCTGCATTTTAGGG + Intergenic
914495210 1:148189873-148189895 GCTTGGTTTTCTGCATTTTAGGG - Intergenic
914569538 1:148902055-148902077 GCTTGGTTTTGTACATTCTAGGG + Intronic
914603290 1:149228201-149228223 GCTTGGTTTTGTACATTCTAGGG - Intergenic
917152972 1:171964523-171964545 GCTTGGTTTTATGCATTTTAGGG - Intronic
918288448 1:183081794-183081816 TCTTGGTGTTGTGCATTCTAAGG + Intronic
918628868 1:186691353-186691375 TCTTGGTGTTGTGCATGCTATGG - Intergenic
920862741 1:209723897-209723919 GCATGCTTTTGTGGATTCTTTGG + Intronic
921627294 1:217390950-217390972 GCTTGGTTTCGTACATTCTACGG - Intergenic
921668501 1:217901110-217901132 GCTTGGTTTTGTACATTTTAGGG + Intergenic
922086009 1:222347383-222347405 ACATGATTTTGTGCATACTAAGG + Intergenic
922234162 1:223710907-223710929 GCTTGGTTTTATACATGTTAGGG - Intronic
922820049 1:228478371-228478393 GCTTGGTTTTATGCATTTTAGGG + Intergenic
923175861 1:231464257-231464279 GCTTGGTTTTGTACATTTTAGGG + Intergenic
923245433 1:232126632-232126654 GCTTGGTTTTATACATTCTAGGG + Intergenic
1063845304 10:10121182-10121204 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1063862344 10:10324760-10324782 GCTTGGTTTTGTACATTTTAAGG + Intergenic
1066249052 10:33615324-33615346 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1067341429 10:45408283-45408305 GCTTGCTTTTGTGCATTTTAGGG + Intronic
1069291252 10:66782983-66783005 GCCTCCTTTTATGCATGCTAAGG - Intronic
1069600936 10:69707435-69707457 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1069738912 10:70675049-70675071 ACATGGTTTTGAGATTGCTATGG + Intronic
1070284677 10:75074104-75074126 GCATGGTTGGGTGCTTGCTGGGG - Intergenic
1070375503 10:75827151-75827173 GCATGTTTTTGTGCGTGCTCAGG + Intronic
1071085042 10:81860123-81860145 GAATGCTTTTGTGCAAGCTCAGG - Intergenic
1071705266 10:87991346-87991368 GTATGCAATTGTGCATGCTATGG + Intergenic
1072570802 10:96655999-96656021 GGGTGGTTTTGTGCAGGCTGAGG - Intronic
1072976772 10:100065701-100065723 TCTTGGTATTGTGCATTCTATGG - Intronic
1073992298 10:109275895-109275917 GATTGGTTTTGTGCATGATTTGG + Intergenic
1076378656 10:130010156-130010178 GCTTGGTTTTATACATTCTAGGG + Intergenic
1082904297 11:58289784-58289806 CCATGGTTTTGTGCATTCGCTGG + Intergenic
1083096525 11:60256502-60256524 GCTTGGTTTTATACATTCTAGGG - Intergenic
1083550269 11:63583247-63583269 GCATGGTTTTGTGGCAGCCATGG + Intronic
1084381910 11:68817975-68817997 GCAGGGTTTTGTGCTAGCAATGG + Intronic
1086389400 11:86346748-86346770 GCATGCTTTTGTGCCAGCTGAGG + Intergenic
1086416904 11:86597789-86597811 GCTTGGTTTTATACATTCTAGGG + Intronic
1086501934 11:87462639-87462661 GCTTGGTTTTGTACATTTTAAGG + Intergenic
1088218730 11:107543414-107543436 GCATTGTCCTGTGCATTCTAGGG - Intronic
1088245542 11:107814611-107814633 TCTTGGTATTGTGCATTCTATGG - Intronic
1088704130 11:112446335-112446357 TCTTGGTGTTGTACATGCTATGG + Intergenic
1090025158 11:123161306-123161328 GACTGGTTTAGTGCATGGTAAGG - Intronic
1091362603 11:134989529-134989551 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1092511352 12:9160139-9160161 CCATAGTTTTGTGAATGTTATGG + Intronic
1093683678 12:22031590-22031612 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1098710396 12:73751189-73751211 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1099443428 12:82725649-82725671 GCTTGGTTTTATACATGTTAGGG + Intronic
1099603070 12:84766024-84766046 GCTTGGTTTTGTACATTTTAGGG - Intergenic
1103111728 12:118285819-118285841 GTTTGGTTTTGTACATTCTAGGG + Intronic
1104108685 12:125686672-125686694 GCAAGCTTTTTTCCATGCTATGG - Intergenic
1107216312 13:37923456-37923478 TTATGGTTTTGTGCATGTTATGG + Intergenic
1108316833 13:49244686-49244708 GCTTGGTTTTGTACATTTTAGGG - Intergenic
1108552789 13:51563362-51563384 TCTTGGTTTTGTACATTCTATGG - Intergenic
1109131621 13:58593679-58593701 TTTTGGTTTTGTGCATCCTATGG - Intergenic
1109531988 13:63662103-63662125 GCATTGTGTTGTACATTCTAAGG + Intergenic
1109707021 13:66108936-66108958 GCATTGTTGTGAGCATGCTGTGG - Intergenic
1110425706 13:75363983-75364005 GCTTGGTTTTCTACATGTTAGGG + Intronic
1112991418 13:105518167-105518189 GCTTGGTTTTGTACATTTTAAGG + Intergenic
1113452815 13:110423768-110423790 CCATGGATTTGAGCGTGCTAGGG + Intronic
1113479884 13:110612868-110612890 GCTTGGTTTTATACATGGTAGGG - Intergenic
1113828639 13:113276751-113276773 GCTTGCTCTTGTGCGTGCTACGG + Intergenic
1113885301 13:113655695-113655717 GGACGGTTTTGTGTTTGCTACGG + Intronic
1116659049 14:47683941-47683963 TCCTGGTTTTGGGCATGCTGAGG + Intergenic
1117388174 14:55237412-55237434 GCCTGGTTTTGTACATCGTAGGG + Intergenic
1117610511 14:57478462-57478484 GCTTCGTTTTGTTCAAGCTAAGG - Intronic
1117902553 14:60550652-60550674 GCATGGGTGTGTGCCTGCTGGGG + Intergenic
1119755693 14:77117680-77117702 GCATGGAGGTGTGCTTGCTAAGG - Intronic
1120367203 14:83586404-83586426 GCATGATTTTGTTCTTTCTATGG - Intergenic
1120694873 14:87633365-87633387 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1126863526 15:52912337-52912359 TCAGGGTTTTGTGGTTGCTATGG + Intergenic
1127500208 15:59547964-59547986 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1129914844 15:79259835-79259857 TCTTGGTTTTGTGCATTCTGTGG + Intergenic
1132529613 16:439685-439707 GCTTGGTTTTATGCATTTTAGGG + Intronic
1134279938 16:12808469-12808491 GCTTGGTTTTATACATTCTAGGG - Intergenic
1138296747 16:55892348-55892370 GCTTGGTTTTATGCATTTTAGGG - Intronic
1140243045 16:73220899-73220921 GGATGTTTTTGTGCATGGGAGGG + Intergenic
1143727324 17:8858264-8858286 GCATGGTTTGGTGCTTGAAAGGG - Intronic
1144902875 17:18614027-18614049 TCTTGGTTTTGTACATTCTATGG - Intergenic
1145028014 17:19483700-19483722 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1147928200 17:43958698-43958720 GCCTGTTTTTGTACATTCTATGG - Intronic
1153446440 18:5178206-5178228 GCATGGTTTTGTGCATGCTATGG + Intronic
1154253363 18:12762821-12762843 GCTTGGTTTTATACATGTTAGGG - Intergenic
1155124806 18:22862669-22862691 TCTTGGTGTTGTGCATTCTATGG + Intronic
1155722638 18:29036569-29036591 TCTTGGTTTTGTACATTCTATGG + Intergenic
1156187646 18:34681846-34681868 TCTTGGTGTTGTGCATTCTATGG + Intronic
1156984117 18:43328870-43328892 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1158382811 18:56953029-56953051 TCTTGGTTTTGTACATTCTATGG - Intronic
1159918454 18:74205916-74205938 GTTTGGTTTTATGCATTCTAGGG - Intergenic
1159924105 18:74251280-74251302 GCTTGGTTTTATGCATTTTAGGG + Exonic
1161953391 19:7479770-7479792 GCTAGGTTTTGGGCATCCTATGG - Intronic
1168519991 19:57042334-57042356 GCTTGGTTTTATACATGTTAAGG - Intergenic
1168650887 19:58091480-58091502 GCCTGGTTCTGTGGATGCTTTGG - Intronic
926204748 2:10828147-10828169 ACTTGGTGTTGTGCATTCTATGG + Intronic
926250182 2:11151227-11151249 GCTTGCTTTTGTGCATTTTAGGG - Intergenic
927061918 2:19431402-19431424 GCAGGGCTTTGTGGATGCTGGGG + Intergenic
932873936 2:75431106-75431128 GCTTGGTTTTATACATGTTAGGG + Intergenic
933136389 2:78741115-78741137 GCTTGGTTTTGTACATTTTAGGG + Intergenic
940962401 2:159800005-159800027 TCTTCGTTTTGTGCATTCTATGG - Intronic
940994009 2:160127539-160127561 GCTTGGTTTTATGCATTTTAGGG - Intronic
941508641 2:166377598-166377620 TCATGGTGTTGTCCATTCTATGG + Intergenic
944161896 2:196671094-196671116 TCTTGGTGTTGTGCATTCTATGG + Intronic
944512143 2:200475350-200475372 GCTTGGTTTTGTACATTTTAGGG + Intronic
948344637 2:237285287-237285309 TCTTGGTGTTGTGCATTCTATGG + Intergenic
949076571 2:242062824-242062846 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1169104950 20:2986828-2986850 TCATAGTTTTGTACATGTTAAGG + Exonic
1170109495 20:12789682-12789704 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1170496249 20:16928213-16928235 TGTTGGTTTTGTGCTTGCTATGG + Intergenic
1170823857 20:19776883-19776905 GCTTGGTTTTATACATTCTAGGG - Intergenic
1171506934 20:25644355-25644377 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1174131641 20:48348600-48348622 GCAGGGCTGTGTGCATGCTCAGG - Intergenic
1175050052 20:56146832-56146854 TCTTGGTATTGTACATGCTAAGG + Intergenic
1175447580 20:59034158-59034180 TCATGGTTTTGTAATTGCTAAGG - Exonic
1176979736 21:15367371-15367393 GCCTGGTTTTGTACATTTTAGGG - Intergenic
1177156604 21:17507198-17507220 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1177160399 21:17541168-17541190 TCTTGGTTTTGTACATTCTACGG + Intronic
1177175963 21:17700978-17701000 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1177254642 21:18645173-18645195 GCATGGCTTTATACATTCTAGGG + Intergenic
1177438399 21:21085610-21085632 GCATAGTGTTCTGCATCCTAGGG - Intronic
1178224168 21:30695896-30695918 TCATGGTGTTGTACATTCTATGG + Intergenic
1178674178 21:34616687-34616709 GCTTGGTTTTATACATGTTAGGG - Intergenic
1183594211 22:38800283-38800305 GCATAGACTTGAGCATGCTAAGG + Intergenic
1183779295 22:39988576-39988598 GCAGGGTTTTGTGCAGGGAAAGG + Intergenic
1183787013 22:40035370-40035392 GCATGGTTTTCTGCACACCATGG - Exonic
950537486 3:13587948-13587970 GCTTGGTTTTGTACATTTTAGGG - Intronic
950999003 3:17536662-17536684 GTTTGGTTTTATGCATGTTAGGG + Intronic
952107386 3:30085970-30085992 GCTTGGTTTTATACATGTTAGGG - Intergenic
952635039 3:35518911-35518933 TCTTGGATTTGTGCATTCTACGG + Intergenic
953709734 3:45259983-45260005 GCCTGGCTTTGTGCCTGATATGG + Intergenic
953747813 3:45588369-45588391 GCTTGGTTTTGTACATTTTAGGG + Intronic
954650110 3:52155995-52156017 GCATGGTTTTATACATTTTAGGG - Intergenic
959171191 3:102846520-102846542 GCTTGGTTTTATACATGTTAGGG - Intergenic
960227634 3:115185560-115185582 GCTTGGTTTTATACATTCTAGGG - Intergenic
960361294 3:116714873-116714895 TCTTGGTTTTGTGCATTCCATGG + Intronic
960710046 3:120518899-120518921 GGATGGTTTTGTGAGTGATAGGG - Intergenic
961679470 3:128589431-128589453 TCTTGGTATTGTGCATTCTATGG + Intergenic
961794324 3:129398744-129398766 GCTTGGTTTTGTACATTTTAGGG - Intergenic
961839407 3:129696415-129696437 GCTTGGTTTTGTACATTTTAGGG - Intronic
962272412 3:133987592-133987614 GCTTGGTTTTGTACATTTTAGGG - Intronic
963226724 3:142869830-142869852 GCTTGGTTTTATGCATTTTAGGG - Intronic
963973617 3:151456565-151456587 GCATGATTTTATGCATTCTTGGG + Intronic
964079694 3:152738583-152738605 GCATTGTTTTGTTGAGGCTAGGG + Intergenic
965637479 3:170798381-170798403 TCTTGGTGTTGTGCATTCTATGG - Intronic
967229354 3:187322939-187322961 GCTTGGTTTTATGCATTTTAGGG + Intergenic
967306638 3:188066078-188066100 GCAGGGTTTTGTACATGTTAGGG - Intergenic
968807198 4:2782064-2782086 GTTTGGTTTTATGCATTCTAGGG + Intergenic
968811727 4:2803045-2803067 GCATGGTTTTGTGCGGTCCAAGG + Intronic
969472922 4:7400260-7400282 GTAAGGGCTTGTGCATGCTACGG + Intronic
970573133 4:17402312-17402334 ACATGGTTTTGTGCTTCCTTTGG + Intergenic
970701495 4:18745851-18745873 TCATGGTATTGTACATTCTATGG + Intergenic
972566294 4:40272343-40272365 GCTTGGTTTTATGCATTTTAGGG - Intergenic
972917827 4:43903139-43903161 GCTTGAGTGTGTGCATGCTAGGG - Intergenic
973661733 4:53114412-53114434 GTATGGTTTTTTGCATTCTGGGG - Intronic
977226514 4:94398294-94398316 GGATGGTTTTATTCATGCTCAGG + Intergenic
977763351 4:100767025-100767047 TCATGGTATTGTACATTCTATGG - Intronic
979025318 4:115565108-115565130 TCTTGGTGTTGTGCATTCTATGG - Intergenic
980246967 4:130258653-130258675 GCTTGGTTTTATACATGTTAGGG - Intergenic
980701884 4:136442370-136442392 GGATGCGTTTGTGCATGCTTGGG + Intergenic
981524704 4:145698322-145698344 GCTTGGTTTTATACATGTTAGGG + Intronic
982350924 4:154414652-154414674 GCATAGTTTTATGCATGAGATGG - Intronic
982938997 4:161524343-161524365 GCTTGGTTTTTTACATTCTAGGG - Intronic
983343320 4:166494484-166494506 GCTTGGTTTTATACATGTTAGGG - Intergenic
983639881 4:169935339-169935361 GCATGCTTCTGTACATTCTAGGG - Intergenic
983918704 4:173320923-173320945 GCATAGTTTGATTCATGCTAAGG + Intronic
984045442 4:174792150-174792172 CCAGGGTTGTGTGCATGCTCAGG - Intronic
984170366 4:176351251-176351273 GCTTGGTTTTGTACATTTTAGGG + Intergenic
984399100 4:179238706-179238728 GCTTGGTTTTATGCATTTTAGGG + Intergenic
984411423 4:179403533-179403555 GCATGTATATGTGCAGGCTAGGG - Intergenic
986839014 5:11674560-11674582 TCTTGGTATTGTGCATTCTATGG + Intronic
987586186 5:19859774-19859796 GCATGGTTTTATACATTTTAGGG - Intronic
987733381 5:21806505-21806527 ACCTGGTTTTGTCCATGCTCTGG + Intronic
989776876 5:45219561-45219583 TCATGGTATTGTACATTCTATGG - Intergenic
990627946 5:57635235-57635257 GGCTGGCTTTGTGAATGCTAAGG + Intergenic
991655281 5:68897873-68897895 GGATGGTTTTGAGCATGAAAGGG - Intergenic
995576985 5:113547449-113547471 TCTTGGTTTTGTGCATTTTACGG - Intronic
999336828 5:150726855-150726877 TCATGGTTTTGTAATTGCTAAGG + Intronic
999987659 5:157020092-157020114 GCTTTGTGTTGTGCATTCTATGG - Intergenic
1000864833 5:166500790-166500812 GCATGGTTTTGAGCCTTCCAAGG + Intergenic
1002573493 5:180157907-180157929 GCTTGGTGTTGTACATTCTATGG - Intronic
1002832951 6:840567-840589 TCTTGGTGTTGTGCATTCTATGG - Intergenic
1003787011 6:9497878-9497900 GCATGGTTTTATACATTTTAGGG + Intergenic
1004240684 6:13918320-13918342 GTTTGGTTTTGTGAATGGTATGG + Intergenic
1004332228 6:14732395-14732417 GCCTGGTTTTGTACATTTTAGGG - Intergenic
1004958816 6:20761870-20761892 GCTTGGTGTTGTTCATTCTAAGG - Intronic
1005660394 6:27992678-27992700 TCTTGGTGTTGTGCATTCTATGG + Intergenic
1007158067 6:39765326-39765348 GCTTGGTTTTGTCCATCCTGAGG + Intergenic
1007509702 6:42365487-42365509 GCATGGTTTTGTGACTGGGAGGG - Intronic
1009358675 6:62787266-62787288 TCATGGTGTTGTACATTCTATGG + Intergenic
1010746537 6:79569046-79569068 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1011534308 6:88359363-88359385 GCATGGTCTTCTGCTTGCAAGGG + Intergenic
1012320922 6:97844501-97844523 TCTTGGTATTGTGCATTCTATGG + Intergenic
1013412682 6:109895818-109895840 GCTTGGTTTTATACATGTTAGGG + Intergenic
1016490689 6:144598199-144598221 GCATGGTTTTATACATTTTAGGG + Intronic
1017778538 6:157698457-157698479 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1017868299 6:158464210-158464232 GCTTGGTTTTGTACATTTTAGGG + Intronic
1018260468 6:161965637-161965659 GCTTGGTTTTATACATGTTAAGG + Intronic
1018713764 6:166516044-166516066 GTTTGGTTTTGTACATTCTAGGG - Intronic
1021096651 7:16542510-16542532 GCTTGGTTTTATGCATTTTAGGG + Intronic
1022990741 7:35704770-35704792 GCATGCCTTTCTGCATGCAATGG - Intergenic
1023396510 7:39756807-39756829 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1023541464 7:41271024-41271046 GCATGGTTATGTGCAGGAGAGGG - Intergenic
1023867080 7:44243412-44243434 GCATGGTTTGGTGAGTGCCAGGG - Exonic
1024032590 7:45476215-45476237 TCTTGGTGTTGTACATGCTATGG - Intergenic
1024822076 7:53343568-53343590 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1025917897 7:65880804-65880826 GCCTGGTTTTGCACTTGCTATGG - Intronic
1026174138 7:67981096-67981118 GCTTGATTTTGTGCATTTTAGGG + Intergenic
1026302141 7:69107283-69107305 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1026562566 7:71462565-71462587 GCTTGGTTTTATACATTCTAGGG + Intronic
1026563096 7:71466897-71466919 ACATGGTTTTATGCATTTTAGGG - Intronic
1026583145 7:71634411-71634433 GCTTGGTTTTATGCATTTTAGGG + Intronic
1026690628 7:72547413-72547435 GCTTGGTTTTATACATGTTAGGG + Intergenic
1026727055 7:72878328-72878350 GCTTGGTTTTATGCATCTTAGGG - Intergenic
1027116779 7:75487292-75487314 GCTTGGTTTTATGCATCTTAGGG + Intergenic
1027275028 7:76548305-76548327 GCTTGGTTTTATGCATCTTAGGG - Intergenic
1027697761 7:81432645-81432667 GCATGGCTATGTGTATACTATGG + Intergenic
1027697908 7:81434099-81434121 GCATGGCTATGTATATGCTATGG + Intergenic
1028318454 7:89433530-89433552 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1029720719 7:102362775-102362797 GCTTGGTTTTATGCATCTTAGGG - Intergenic
1031227659 7:119061059-119061081 GTTTGGTTTTATGCATTCTAGGG + Intergenic
1031368930 7:120939817-120939839 GCATGATTTTGAGCATGTGATGG + Intergenic
1032178471 7:129653530-129653552 TCATGGTATTGTACATTCTATGG + Intronic
1034333471 7:150304575-150304597 GTTTGGTTTTGTACATGCTGAGG - Intronic
1034664572 7:152805315-152805337 GTTTGGTTTTGTACATGCTGAGG + Intronic
1035359831 7:158304040-158304062 GCTTGGATTTCTACATGCTAGGG + Intronic
1035359838 7:158304103-158304125 GCTTGGATTTCTACATGCTAGGG + Intronic
1035359844 7:158304166-158304188 GCTTGGATTTCTACATGCTAGGG + Intronic
1035359850 7:158304229-158304251 GCTTGGATTTCTACATGCTAGGG + Intronic
1035359857 7:158304291-158304313 GCTTGGATTTCTACATGCTAGGG + Intronic
1035359870 7:158304415-158304437 GCTTGGATTTCTACATGCTAGGG + Intronic
1035963393 8:4162787-4162809 TCTTGGTATTGTACATGCTATGG + Intronic
1036296818 8:7543983-7544005 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1036325749 8:7777036-7777058 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1038591861 8:28846472-28846494 GCATAGTTTTGAGCAAGGTAAGG - Intronic
1039624115 8:39030137-39030159 TCTTGGTGTTGTGCATTCTATGG + Intronic
1040397965 8:47017427-47017449 GCAAAGTTTAGTGAATGCTATGG - Intergenic
1041005035 8:53489451-53489473 TCTTGATTTTGTACATGCTATGG - Intergenic
1041339722 8:56831599-56831621 TCTTGGTGTTGTGCATTCTATGG - Intergenic
1042243985 8:66692709-66692731 GCTTGGTGTTGTACATTCTATGG - Intronic
1044184221 8:89233279-89233301 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1045125976 8:99089438-99089460 CCTTGGTTTTGTGCATTTTATGG + Intronic
1045812721 8:106242382-106242404 GAAAGGTTTTCTACATGCTAGGG + Intergenic
1046667861 8:117024612-117024634 ATATGCTTTTGTGTATGCTAGGG - Intronic
1047012155 8:120684317-120684339 ACATGAATTTGGGCATGCTAGGG - Intronic
1047113900 8:121819159-121819181 GCTTGGTTTTATGCATTTTAGGG + Intergenic
1047558731 8:125963465-125963487 GCTTGGTTTTATACATTCTAGGG - Intergenic
1048370181 8:133770349-133770371 GCTTGGTTTTATACATGCTGGGG - Intergenic
1048797515 8:138164743-138164765 GCTTGGTTTTATGCATTTTAGGG - Intronic
1048892894 8:138963683-138963705 GCTTGGTTTTGTACATTTTAGGG + Intergenic
1049933994 9:483213-483235 CCATGGTTTTGGGCATCCTCTGG + Intronic
1050330218 9:4538207-4538229 GCTTGGTTTTGTACATTTTAGGG + Intronic
1050432658 9:5577607-5577629 GCATGGTTATGTGCTTGCTTTGG - Intergenic
1051552502 9:18345839-18345861 ACATGGTCTTCTGGATGCTAAGG - Intergenic
1052047462 9:23811147-23811169 ACATTGTTTTGTGGATGGTAGGG - Intronic
1057338654 9:94179169-94179191 GCATGGTTTTGTTTTTGCTCAGG + Intergenic
1057843751 9:98506389-98506411 GCATGGATGAGTGCATGCTGAGG + Intronic
1057909549 9:99006995-99007017 GCTTGGTTTTGTGCATTTTAGGG + Intronic
1057910246 9:99014743-99014765 GCTTGGTTTTATGCATTTTAGGG + Intronic
1058996886 9:110307857-110307879 GCTTGGTTTTATACATGTTAGGG - Intronic
1061426173 9:130499732-130499754 GCATGCTTCTGAGGATGCTATGG - Intronic
1062258832 9:135647198-135647220 GCTTGGTTTTATGCATTTTAAGG - Intergenic
1185687124 X:1938536-1938558 GCATGGTTTCAGGAATGCTATGG + Intergenic
1185738917 X:2514669-2514691 GCTTGGTTTTATGCATCTTAGGG + Intergenic
1187817414 X:23247706-23247728 GTTTGGTTTTATGCATTCTAGGG - Intergenic
1191729073 X:64314556-64314578 GCCTGGCTTTGTGCCTGCCAAGG + Intronic
1192916607 X:75658051-75658073 GAAAAGTTTTCTGCATGCTAAGG + Intergenic
1193972137 X:88067674-88067696 CCTTGGTTTTATACATGCTAGGG + Intergenic
1195798688 X:108682193-108682215 TGATGGTTTTGTCCATGCAAAGG + Intronic
1196542289 X:116923908-116923930 GCTTGGTTTTATACATGTTAGGG + Intergenic
1197028922 X:121789953-121789975 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1197353837 X:125410036-125410058 GTAGGGTTGTGTGCATGCTCAGG - Intergenic
1197865775 X:131015125-131015147 TCATGGTGTTGTACATTCTATGG + Intergenic
1199232962 X:145460747-145460769 GCTTGGTTTTATGCATTTTAGGG - Intergenic
1199251610 X:145669092-145669114 GCTTGGTTTTGTACATTTTAGGG - Intergenic
1199381008 X:147172592-147172614 GCTTGGTTTTATACATGTTAGGG + Intergenic
1200411584 Y:2867179-2867201 GCATTCTTTTGTGGAAGCTATGG + Exonic
1201309935 Y:12587896-12587918 GCTTGGTTTTATGCATTTTAGGG + Intergenic