ID: 1153450468

View in Genome Browser
Species Human (GRCh38)
Location 18:5221828-5221850
Sequence CTCTGATGGCACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5019
Summary {0: 3, 1: 33, 2: 412, 3: 1410, 4: 3161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153450468_1153450471 -7 Left 1153450468 18:5221828-5221850 CCAAGATCAAGGTGCCATCAGAG 0: 3
1: 33
2: 412
3: 1410
4: 3161
Right 1153450471 18:5221844-5221866 ATCAGAGTTGGTTTCTGATAAGG No data
1153450468_1153450472 6 Left 1153450468 18:5221828-5221850 CCAAGATCAAGGTGCCATCAGAG 0: 3
1: 33
2: 412
3: 1410
4: 3161
Right 1153450472 18:5221857-5221879 TCTGATAAGGCTTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153450468 Original CRISPR CTCTGATGGCACCTTGATCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr