ID: 1153456675

View in Genome Browser
Species Human (GRCh38)
Location 18:5290722-5290744
Sequence ACTGGACTTAAGGCAGTGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153456675_1153456679 20 Left 1153456675 18:5290722-5290744 CCAAGCACTGCCTTAAGTCCAGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1153456679 18:5290765-5290787 TTCCACAAAAATATTGTAACTGG 0: 1
1: 0
2: 0
3: 33
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153456675 Original CRISPR ACTGGACTTAAGGCAGTGCT TGG (reversed) Exonic
902202333 1:14843218-14843240 ACTAGACTCAAGGCAGTGTGTGG + Intronic
904365374 1:30007798-30007820 ACTGAAGGTGAGGCAGTGCTGGG - Intergenic
905240459 1:36577681-36577703 CCTTGACTTCGGGCAGTGCTGGG - Intergenic
905415052 1:37798197-37798219 ACTGGGCTTAAGTCAGTGCCTGG - Intronic
907714589 1:56915393-56915415 ACTGGAAAAAAGGCACTGCTTGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907822111 1:57980376-57980398 AGTGGAGATAAGGAAGTGCTTGG - Intronic
907935826 1:59041456-59041478 ACTGTACTTAAGGAAGGGCAAGG + Intergenic
915073081 1:153288486-153288508 ACTAGTCCCAAGGCAGTGCTGGG + Intergenic
915588627 1:156858625-156858647 ACTGGACACAAGCCAGGGCTGGG - Exonic
916979387 1:170116688-170116710 ACTGGACTGAAGGCCTTGCAGGG + Intergenic
918300516 1:183199567-183199589 ACTGTACCTAATGCAGTGCTTGG - Intronic
920557703 1:206916137-206916159 AGTGGGTTTAAAGCAGTGCTGGG - Intronic
1063038071 10:2308427-2308449 ACTGGACATCAGGCAGTGAGGGG + Intergenic
1066211299 10:33241480-33241502 TAAGGACTTCAGGCAGTGCTAGG - Intronic
1066490245 10:35887479-35887501 ACTGGACTCAGGGCAGGGCTGGG + Intergenic
1067769161 10:49111107-49111129 GCTGGGTTTAAGGCAGGGCTGGG - Intronic
1068423185 10:56822323-56822345 ACTGTACCACAGGCAGTGCTTGG + Intergenic
1070187223 10:74076251-74076273 ACGGGACTCTAGGCAGTGCTGGG + Intronic
1072810154 10:98455214-98455236 ACTGGGGGTAAGGCACTGCTAGG + Intergenic
1074720120 10:116256990-116257012 CCAGGACAAAAGGCAGTGCTGGG + Intronic
1078127831 11:8585617-8585639 AATGGACCTCAGGCAGGGCTTGG + Intronic
1081254346 11:40873732-40873754 AATGAACTTAAGGCAGAGGTAGG - Intronic
1081803082 11:45872955-45872977 ACTGGTCCTCAGGCAGGGCTGGG - Intronic
1083610493 11:64002018-64002040 AATGTGCTTAAGGCAGTGCTTGG + Intronic
1083854728 11:65387041-65387063 ACGGGACAGAAGGCAGTGCCGGG + Exonic
1086472695 11:87132301-87132323 ACAGTACCTAAGGCAGTGATTGG + Intronic
1087145450 11:94806206-94806228 ACTGGACTTGCTGCACTGCTGGG - Intronic
1090934731 11:131331222-131331244 ACAGGACCTAAGGCCGTGCCAGG + Intergenic
1092271160 12:7024513-7024535 ACTGGACTTCACAAAGTGCTGGG - Intronic
1093789403 12:23230234-23230256 ACTGGACTTTGAGCAGTTCTAGG - Intergenic
1094403935 12:30094442-30094464 ACAGGAGTAAAGGCAGTGCGGGG - Intergenic
1096232831 12:49905975-49905997 GCTGGACTGAATGCAGTGCCAGG + Intergenic
1096504331 12:52083035-52083057 ACTGGACCTCTGGAAGTGCTCGG + Intergenic
1096663917 12:53149465-53149487 CCAGGAAATAAGGCAGTGCTGGG + Intergenic
1096967577 12:55640518-55640540 ACAGGACTTAAGGCCATGCCAGG - Intergenic
1097705814 12:62867099-62867121 ACAGAACTTAAGACAGTGCATGG + Intronic
1098622734 12:72623723-72623745 GCAGGACTGAAGGCAGTGGTAGG + Intronic
1104059177 12:125253278-125253300 AATGGACTTAACGCAGTGCCTGG - Intronic
1106062552 13:26309050-26309072 CCTGTACTTACGACAGTGCTAGG + Intronic
1106190488 13:27448745-27448767 ACTGGACTTACGGCCGGGCACGG + Intronic
1107432593 13:40353126-40353148 GCTGTACTTAAGGCAGTCCTTGG - Intergenic
1112050323 13:95639073-95639095 ACTGTGCTTAGAGCAGTGCTTGG - Intronic
1114349620 14:21835802-21835824 ACTGGCCTGAAGGCACTCCTTGG - Intergenic
1119630381 14:76227030-76227052 CCTGGGCTTAAAGCAGAGCTGGG - Intronic
1120069149 14:80083365-80083387 ACTGTCCTTAAGGGAGTTCTTGG + Intergenic
1122170818 14:99873371-99873393 ATTGCACTGAAGCCAGTGCTGGG + Intronic
1122675339 14:103408107-103408129 ACAGAACTTAACACAGTGCTTGG + Intronic
1122893556 14:104744135-104744157 GCTGGACACAGGGCAGTGCTGGG + Intronic
1130113528 15:80986720-80986742 ACTGGCCTGGAGGCAGGGCTAGG - Intronic
1133743286 16:8667860-8667882 ACTTGACTTCTGACAGTGCTTGG - Intergenic
1134202569 16:12210997-12211019 TCTGCACTAAAGGCTGTGCTGGG - Intronic
1134336758 16:13307233-13307255 ACAGGACTTAAGCCACTGCCTGG + Intergenic
1135814172 16:25616897-25616919 ACTTGACCTAAGGCAGAGCAAGG - Intergenic
1138659642 16:58509594-58509616 ACTGTTCTGATGGCAGTGCTGGG + Intronic
1139905340 16:70361744-70361766 ACTGGGCTTAAGGCCGGGCATGG + Intronic
1140136576 16:72211086-72211108 AATGCACTTAAGGGTGTGCTAGG + Intergenic
1140377107 16:74453373-74453395 ACTGGGCTGGTGGCAGTGCTAGG + Intronic
1141405317 16:83787604-83787626 GCTGGTCTTTGGGCAGTGCTGGG - Intronic
1141805185 16:86337241-86337263 GCGGGCCTTAAGGCCGTGCTGGG + Intergenic
1142190821 16:88716530-88716552 CCTGGACTTGGGGCAGTGCCTGG - Intronic
1145714575 17:27007895-27007917 AATGGGCTGAAGACAGTGCTGGG + Intergenic
1146642325 17:34550643-34550665 ACTGGACCAAAGGCAGACCTAGG - Intergenic
1150472751 17:65451049-65451071 GCTGGATTTCAGGGAGTGCTTGG + Intergenic
1152635578 17:81429336-81429358 ACTGAACTGAAGGCAGAGCAGGG - Intronic
1153456675 18:5290722-5290744 ACTGGACTTAAGGCAGTGCTTGG - Exonic
1156790789 18:40971043-40971065 ACTAGTGTTAAAGCAGTGCTTGG - Intergenic
1162833160 19:13299370-13299392 ACAGGACTTAGAGCATTGCTAGG + Intronic
1164948499 19:32316303-32316325 CCTGGACTCAAGAAAGTGCTGGG - Intergenic
1168502828 19:56907988-56908010 CCTGGACTTGAGGCAATACTAGG - Intergenic
925347059 2:3178834-3178856 CCTGGATTTTAGGCTGTGCTGGG - Intergenic
926918480 2:17916057-17916079 AATGAACTTTAGGCGGTGCTTGG + Intronic
927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG + Intronic
927789177 2:25996812-25996834 ACTGGACCTCATGCACTGCTGGG - Intergenic
928299893 2:30115807-30115829 CCTGGCCTTCAGGAAGTGCTGGG - Intergenic
928593540 2:32840097-32840119 ACTGGAGTCAAGCCAGTGCTGGG - Intergenic
929571439 2:43025551-43025573 ACTGGAGCTCAGTCAGTGCTGGG + Intergenic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
931531763 2:63222618-63222640 ACTATGCTTAAGGCAGTGCCTGG + Intronic
933311209 2:80663735-80663757 CCAGCACTTAAAGCAGTGCTTGG - Intergenic
933864918 2:86507668-86507690 ACTGGACTTAGGCTAGAGCTCGG - Intronic
934040691 2:88125587-88125609 CCTAGACTGAAGGCAGTGCAGGG - Intronic
935874624 2:107493508-107493530 ACAGGACCTAAGGCCATGCTAGG - Intergenic
939446826 2:142321201-142321223 ATTGGTCTTAAGACAGTGCCAGG + Intergenic
940897450 2:159094557-159094579 ACAGATCTTAAGGCAGAGCTAGG - Intronic
942606724 2:177699766-177699788 AGGGGACTGGAGGCAGTGCTGGG + Intronic
942623257 2:177871350-177871372 AGTGCACCTAAGGTAGTGCTGGG + Intronic
943507223 2:188776455-188776477 AATGGAGTTAAAGCAGTGCTTGG - Intronic
945164150 2:206924392-206924414 ACTGGACTTGACACTGTGCTAGG + Intergenic
946909370 2:224444432-224444454 ACAGGTCTTAAGGGAGCGCTGGG - Intergenic
1169120416 20:3092685-3092707 GCTAGACTTAAGGAAGAGCTAGG + Intergenic
1169613895 20:7416657-7416679 AATGCACTTAAGACAGTGGTAGG - Intergenic
1170921900 20:20687024-20687046 ACAGGACTATAGGCAGGGCTTGG - Intronic
1174368008 20:50068051-50068073 GCTGGGCCTAGGGCAGTGCTGGG + Intergenic
1174935982 20:54869252-54869274 AGAGCATTTAAGGCAGTGCTTGG - Intergenic
1180092065 21:45538357-45538379 ACTAGACTCATGGCACTGCTGGG + Intronic
1181294410 22:21824003-21824025 GCTGGTATTATGGCAGTGCTTGG - Intronic
1181974119 22:26716487-26716509 CCTGGACTCAAGCAAGTGCTGGG - Intergenic
1182105570 22:27686615-27686637 AATGGACTTAACTCAGTGCCTGG + Intergenic
1182447068 22:30396054-30396076 CCTGGAATTAATGCAGAGCTAGG - Intronic
1183344651 22:37300639-37300661 ACTGGGCTGCAGTCAGTGCTGGG + Intronic
1184041030 22:41943748-41943770 GCTGGAATTCAGGAAGTGCTGGG + Intronic
949757592 3:7430998-7431020 ACTGGACTTGAGGGAGTTGTGGG + Intronic
950097922 3:10340725-10340747 GCTGGGCTGAAGGCAGTGGTGGG + Intronic
950615085 3:14151778-14151800 ACTGGCTTTAAGGCAGAGCCTGG + Intronic
951547377 3:23840896-23840918 ACTGGACATCAGGTAGTGCAAGG - Intronic
951588642 3:24240289-24240311 GCAGGATTTAAGGCAGTCCTGGG + Intronic
952327780 3:32336386-32336408 TGTGGACCTGAGGCAGTGCTGGG + Intronic
952720711 3:36529829-36529851 CTTGGACTTACGGCAGGGCTCGG + Intronic
953230192 3:41057964-41057986 ACTGGCCTTAGGGCTGTGTTTGG + Intergenic
956062999 3:65367563-65367585 AATGGACTTAGCACAGTGCTTGG - Intronic
960856561 3:122107964-122107986 ACTGAACTTCAGGCATAGCTTGG - Intronic
961513953 3:127421289-127421311 ACTGTATTTACGGCAGTGCCTGG - Intergenic
965210824 3:165785532-165785554 ACTAGTCTTAAGGAAGTGATTGG - Intronic
969874305 4:10124505-10124527 ACTGGACTTAAGGCACAACCTGG + Intergenic
970497336 4:16639834-16639856 CCTGCCCTTAGGGCAGTGCTAGG - Intronic
971145115 4:23968013-23968035 ACTGGAAGTAAGGAAGTACTTGG + Intergenic
971231237 4:24801279-24801301 AATGGACCTAAGGCTGTACTCGG - Intergenic
972586933 4:40446445-40446467 ACTGAACTTAAGGCTGGGCGTGG + Intronic
975120790 4:70726216-70726238 AATGAACATAAGGCAGTGCCTGG + Intronic
976925082 4:90486139-90486161 ACTGTACTTAACACAGTTCTTGG - Intronic
980961126 4:139477129-139477151 ACTGGACTAAAAGAAGAGCTGGG + Intergenic
981952009 4:150421832-150421854 AGTGGCCTGAAAGCAGTGCTTGG - Intronic
982021210 4:151206783-151206805 GCTGAACTTTGGGCAGTGCTGGG + Intronic
986363136 5:7001568-7001590 ACTGGACACCAGTCAGTGCTAGG + Intergenic
986846516 5:11762758-11762780 ACTAGACAGAAGGCAGTACTGGG - Intronic
987999533 5:25330924-25330946 TCTGGACTTTAGGCATTGATAGG + Intergenic
991482530 5:67097063-67097085 ACTTGACTGAAGGCAATGCAAGG - Intronic
991584965 5:68192649-68192671 GCTGGACCTATGGCAGAGCTGGG - Intronic
993753799 5:91702286-91702308 ACTGGGTTTAAGTTAGTGCTAGG + Intergenic
995375117 5:111465189-111465211 GTTGCACTTAAGGCAGTGCTAGG + Intronic
997848294 5:137308153-137308175 ACTGGACTTCAGCCAGTGCAGGG + Intronic
998424397 5:142014229-142014251 CCCGGACTTTAGTCAGTGCTAGG + Intergenic
998934901 5:147224812-147224834 ATTGCACTTAAAACAGTGCTAGG - Intergenic
999269032 5:150285685-150285707 AATTGACTCAAGGCAGAGCTGGG - Intronic
1000589734 5:163144113-163144135 ACAAGACCTAAGGCTGTGCTAGG - Intergenic
1004269870 6:14185536-14185558 ACTGGACTTAGGGCATCCCTGGG - Intergenic
1005295362 6:24420506-24420528 AATGGGCCTAAAGCAGTGCTTGG - Intronic
1006092456 6:31636142-31636164 AGTGGACTTAAGGCATTGCTAGG + Intronic
1013477212 6:110520087-110520109 ACTGGACACAAAGCAGTACTTGG - Intergenic
1013602504 6:111718269-111718291 ACAGGACTGAAGGCAGTATTGGG + Intronic
1014292187 6:119571323-119571345 ACAAGACTTAAGGCAGTGTAAGG + Intergenic
1019971865 7:4547951-4547973 CCTGCACTTAACGCAGTGCCTGG + Intergenic
1021066130 7:16175068-16175090 ACTGTACTTTAGGCAGTCCATGG + Intronic
1021924634 7:25522339-25522361 CCAGGACTTAAGGCAGAGCCAGG + Intergenic
1022029880 7:26482764-26482786 AATGTAATTAAGGCAGTGATGGG - Intergenic
1024404787 7:48966071-48966093 ACAGGGCAAAAGGCAGTGCTTGG - Intergenic
1029311768 7:99673827-99673849 ACTGGACAGAAGGCGATGCTGGG + Intronic
1030426679 7:109387369-109387391 ACTGAGCTTTATGCAGTGCTGGG + Intergenic
1032820831 7:135522927-135522949 AATGGAGTTAAGGCAGTATTTGG + Intergenic
1033586646 7:142779384-142779406 CCTGGCCTGAAGACAGTGCTTGG + Intergenic
1036204041 8:6792510-6792532 CCAGGACTTAGAGCAGTGCTTGG - Intergenic
1037843717 8:22264046-22264068 ACTGCACGTAGAGCAGTGCTAGG + Intergenic
1038087177 8:24211613-24211635 AGTGGACTCAAGGCACTGCTTGG + Intergenic
1039539775 8:38355308-38355330 ACAGCACTTAAGACAGTGCCTGG + Intronic
1040731935 8:50457839-50457861 GCTGTACTTATGGCAGTGCCTGG - Intronic
1042331860 8:67588887-67588909 CCTGGACTCAAGTGAGTGCTGGG - Intronic
1043251765 8:78083776-78083798 ACTGGAGTTAAAGCAGTGGCTGG + Intergenic
1044332850 8:90941821-90941843 TCTGAACTTGAGGCAGTGCATGG - Intronic
1044708473 8:95031690-95031712 CCTGGGCTTAAAGCAGTTCTCGG + Intronic
1044906669 8:97011567-97011589 ATTGGACATTAGGCAGTCCTAGG + Intronic
1049041193 8:140113164-140113186 ACAGGACATAAGTCACTGCTGGG - Intronic
1051563493 9:18469890-18469912 TCTGGACTTCAGGCACTGGTTGG + Intergenic
1052812848 9:33076633-33076655 ACTGGCCTTGAGGGAGAGCTGGG - Exonic
1053382478 9:37660220-37660242 GCTGGAAGTAAGTCAGTGCTGGG + Intronic
1056417339 9:86389723-86389745 ACTGAACTTTAGGAAGTACTAGG + Intergenic
1059747397 9:117216397-117216419 GCTGAACTCAAGGCAGGGCTTGG - Intronic
1061637311 9:131920751-131920773 AAAGGCCTTAAGGCAGCGCTGGG + Intronic
1185969422 X:4645899-4645921 ACTGGAAAAAAGGCAGTTCTAGG - Intergenic
1186034131 X:5402731-5402753 ACAGGACCTAAGGCTGTGCCAGG - Intergenic
1186175939 X:6925913-6925935 ACAGGACCTAAGGCTGTGCTGGG - Intergenic
1186497277 X:10021648-10021670 GCTGGCCTTGAGGAAGTGCTGGG + Intronic
1188610308 X:32087897-32087919 TCTGGATATAAGGCACTGCTGGG + Intronic
1189720999 X:43917532-43917554 ACTGGACATCAGGCTGTGCAGGG - Intergenic
1189944509 X:46164352-46164374 CCTGGACTTAAGTCAGTTTTTGG - Intergenic
1198956577 X:142137914-142137936 ATTGGCCTTAAGGCAGGGGTGGG + Intergenic
1199887040 X:152030506-152030528 TCTGGACATAAAGCAGTACTTGG - Intergenic
1199900534 X:152167990-152168012 ACTGGACAAATGGCAGTGTTTGG + Exonic