ID: 1153468389

View in Genome Browser
Species Human (GRCh38)
Location 18:5415569-5415591
Sequence CATCCCACGTAGAACTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153468389 Original CRISPR CATCCCACGTAGAACTCAGT GGG Intronic
903274682 1:22212967-22212989 AATCCCACCTGGAACTCGGTGGG - Intergenic
904307617 1:29600311-29600333 CATCCCAGCTTGAACTCAGAAGG + Intergenic
908682010 1:66672580-66672602 CATACCACATAGACCTCACTGGG + Intronic
912737615 1:112164095-112164117 CATCCTAGGAAGAACTCATTAGG + Intergenic
912873237 1:113328815-113328837 CAACCCAGGCAGAACTCAGCTGG - Intergenic
1065385630 10:25130639-25130661 GGCCCCATGTAGAACTCAGTTGG + Intergenic
1068864351 10:61879430-61879452 CATCCAACATAGAAGGCAGTTGG + Intergenic
1070643787 10:78187391-78187413 CATCCCTCTTGGACCTCAGTGGG - Intergenic
1071670652 10:87606479-87606501 CAGCCCATTTAGAACTCAGGGGG - Intergenic
1077161684 11:1116142-1116164 AATCCCACGAAAAACTCAGCTGG - Intergenic
1077446024 11:2591290-2591312 CATCCCATGTGGAAGTCAGCAGG + Intronic
1077894584 11:6444079-6444101 CAGCACACCTAGCACTCAGTGGG - Intergenic
1080026917 11:27624999-27625021 CATCACACATAGAATACAGTAGG + Intergenic
1080101892 11:28468860-28468882 AATCCCAGGTGGCACTCAGTTGG + Intergenic
1082170589 11:49000265-49000287 AATCCCACATTGAATTCAGTGGG + Intergenic
1085951600 11:81339053-81339075 CTTGCCAGGTAGTACTCAGTTGG + Intergenic
1086456866 11:86967829-86967851 CATCCCAGGTCGATCTCAGATGG + Intergenic
1086695222 11:89836086-89836108 AATCCCACATTGAATTCAGTGGG - Intergenic
1086710929 11:90008398-90008420 AATCCCACATTGAATTCAGTGGG + Intergenic
1089267405 11:117274794-117274816 CCTCCCAAGTAGAACACAGATGG + Intronic
1092963852 12:13622699-13622721 CATCCCACGCAGAAGGCAGAAGG + Intronic
1098871541 12:75822489-75822511 CATCCCACGTAGATGTCTCTGGG + Intergenic
1111001228 13:82185788-82185810 CATGCCATGTAAAACTCAGTGGG - Intergenic
1117299286 14:54407873-54407895 CATTCCAAGTACCACTCAGTTGG + Intronic
1119072881 14:71605966-71605988 CACACCACTTAGAACTCAGAGGG - Intronic
1119948743 14:78722727-78722749 CCTGGCACGTAGCACTCAGTAGG - Intronic
1122498955 14:102181857-102181879 CAACCCACTTAGAACTGAATAGG - Intronic
1127056257 15:55135326-55135348 CATTCCAGGTACTACTCAGTTGG - Intergenic
1127869290 15:63057244-63057266 GATCCCAGGTATAACTCGGTTGG + Intronic
1129321817 15:74779514-74779536 CTTCCCACCTAGCACTTAGTAGG + Intergenic
1131524571 15:93142841-93142863 CATCCCACGCAGGCCTCAGGAGG - Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1138371543 16:56530874-56530896 CATCCCCAGTGGAACTCAGATGG + Intergenic
1139498472 16:67339787-67339809 CATACCACGGAGAAATTAGTGGG - Intronic
1144050803 17:11495719-11495741 CATCCCTCTGAGAACTAAGTGGG + Intronic
1151354637 17:73551109-73551131 CAGCCCACGAAGGACACAGTGGG + Intronic
1153132428 18:1871059-1871081 CATCCCAGGTAGAACAAAGTAGG + Intergenic
1153468389 18:5415569-5415591 CATCCCACGTAGAACTCAGTGGG + Intronic
1157539445 18:48489430-48489452 CAACACACCCAGAACTCAGTGGG - Intergenic
1161783810 19:6310993-6311015 GATCCCAGGGAGGACTCAGTAGG + Intronic
925493875 2:4424612-4424634 CATCCCAGGTGGGACACAGTGGG - Intergenic
925534811 2:4904936-4904958 CATCCCATGTAGACCCCTGTGGG - Intergenic
930194141 2:48492434-48492456 CATTTCACGTGGAACTCACTAGG + Intronic
941782883 2:169464075-169464097 CTTCCCAGGTAGAAATCAGAAGG - Intergenic
944902146 2:204226409-204226431 AATCCAAGGTAGAACTAAGTGGG - Intergenic
1176237380 20:64059909-64059931 CATCCCAGGGAGAAATCAGGTGG + Intronic
1181788464 22:25244375-25244397 AATCCCACGCAGAAGTCAGAGGG + Intergenic
1182511190 22:30821641-30821663 CATCCCACGGAGATTTCGGTGGG + Intronic
1183473982 22:38025889-38025911 CATCCCATGTAGAAGACAGGAGG - Intronic
953121448 3:40046562-40046584 CATCCTAGATGGAACTCAGTTGG + Intronic
961820808 3:129574840-129574862 GATCCCACCCAGACCTCAGTGGG + Intronic
967949234 3:194828039-194828061 CATCCCAGGAAGAAGGCAGTAGG + Intergenic
970247140 4:14075448-14075470 GATCCCATGTAGAAGTCAGCTGG + Intergenic
970415470 4:15852684-15852706 CAATCCACCAAGAACTCAGTAGG + Exonic
975381502 4:73705518-73705540 CATCGCAGGTAGAATTCAGAGGG - Intergenic
978455936 4:108891407-108891429 CTTCCCATTTGGAACTCAGTTGG - Intronic
994524555 5:100887368-100887390 AAACCCAAGTAGAGCTCAGTTGG + Intronic
994875637 5:105417413-105417435 CATCCAACATAATACTCAGTGGG + Intergenic
999746957 5:154599934-154599956 AATCCCAGGCAGAACTAAGTAGG + Intergenic
1004773192 6:18810379-18810401 CCTTCCACGTAGAACAGAGTGGG + Intergenic
1005267676 6:24129386-24129408 CAACCCACGTAGAACTCTGCAGG + Intronic
1009331177 6:62422597-62422619 CAACCCACGTACAACTCAGGTGG - Intergenic
1019630760 7:2048395-2048417 CATCTCACTTAAAACTCACTTGG - Intronic
1028910930 7:96206677-96206699 CATCCCACATAGGACACTGTGGG + Intronic
1046029995 8:108772317-108772339 CATGCCACATACAAGTCAGTTGG - Intronic
1049011422 8:139890158-139890180 CAGCACACGTGGAACCCAGTGGG + Intronic
1051944581 9:22551919-22551941 TATCCCACATAGATCTCACTGGG + Intergenic
1055818806 9:80238102-80238124 CCTCCCCCTGAGAACTCAGTAGG - Intergenic
1059316227 9:113427982-113428004 AATCTCAAGTAGAACTCAGAAGG + Intronic
1193603793 X:83541448-83541470 CATCTCAAGTAGAAATCAATGGG - Intergenic
1196765103 X:119236073-119236095 CCTCCCAGGTAGAACTGAGGGGG + Intergenic