ID: 1153469443

View in Genome Browser
Species Human (GRCh38)
Location 18:5427648-5427670
Sequence CAGGACAAACAGAAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153469439_1153469443 29 Left 1153469439 18:5427596-5427618 CCTTGAAGTACAGGACCTCTAAA 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG 0: 1
1: 0
2: 3
3: 46
4: 614
1153469440_1153469443 14 Left 1153469440 18:5427611-5427633 CCTCTAAACTGTTCACTTTAAAG 0: 1
1: 7
2: 63
3: 422
4: 1913
Right 1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG 0: 1
1: 0
2: 3
3: 46
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153469443 Original CRISPR CAGGACAAACAGAAAGAGCA TGG Intronic
900239922 1:1611367-1611389 CAGGACACAGAGAGAAAGCAGGG + Intergenic
901391646 1:8949913-8949935 AAGGTCAGACAGAAAAAGCAGGG + Intronic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902136701 1:14312625-14312647 CAGTACAAACTCAAAGAGAAGGG - Intergenic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
903582610 1:24383263-24383285 CAAGAAAAACAGATACAGCAAGG - Intronic
905799140 1:40832278-40832300 CAGCACAGGCAGAAACAGCATGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907701673 1:56794283-56794305 AAGGACCAGCAGGAAGAGCATGG - Intronic
908566567 1:65363068-65363090 CAGGACAGAGAAAGAGAGCAAGG + Intronic
908646909 1:66288183-66288205 CATGACACACAGCCAGAGCAGGG + Intronic
908650687 1:66329471-66329493 CAGTACAAAATGAAAGTGCAGGG - Intronic
909156427 1:72083517-72083539 AAAGACAAACAGAGAGAGCTGGG - Intronic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
910388179 1:86706651-86706673 TAGGACAAACAAAAATACCAAGG - Intronic
912516017 1:110216981-110217003 CAGGACCAGGAGAGAGAGCAGGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914249104 1:145907204-145907226 TAGGCCAAAGGGAAAGAGCATGG + Intronic
915054920 1:153119383-153119405 CAGGAGAACCAGAAAGACCACGG + Intergenic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
916338330 1:163698441-163698463 CAGAGCACACAGAAAGAGCTTGG - Intergenic
917127100 1:171696685-171696707 CAGGAGAAACAGCAAGTCCAAGG + Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920431330 1:205921124-205921146 CAGGCCAAACAGAGAGCCCACGG - Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920937752 1:210451421-210451443 CAGAACAAACTGAACGAGAAAGG + Intronic
921326350 1:213989017-213989039 CAAGACAAAGAGAAAGGACAAGG - Intronic
921732352 1:218592528-218592550 CAGGACAAAAAGAAAAAAAATGG - Intergenic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922346224 1:224699025-224699047 AAGGACTATCAGAAAGGGCAGGG - Intronic
923307454 1:232701395-232701417 GAGGACAGATACAAAGAGCAGGG + Intergenic
923673228 1:236059167-236059189 CAAGTGTAACAGAAAGAGCACGG - Intronic
923728792 1:236531050-236531072 TAGGTCAAATAGAAAAAGCAGGG - Intronic
923940319 1:238816363-238816385 AAGGACAGACAGAAAGTACAAGG + Intergenic
924124725 1:240838428-240838450 CAGGACACACATACAGAGAAAGG + Intronic
924852228 1:247841801-247841823 CAGGAAAATGACAAAGAGCAGGG + Exonic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1065089517 10:22217997-22218019 CAGGACCTAGAGAAAGAGCAAGG + Intergenic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1065208612 10:23381165-23381187 CAGAACAAACTGAAAGACCATGG + Intergenic
1065474439 10:26118932-26118954 CTGGGCCAACAGAAAGAGCTTGG - Intronic
1065906600 10:30259266-30259288 TAAGACAAACAGAAAGAGTGGGG + Intergenic
1067161405 10:43827905-43827927 CTGGACAAGCAGCAAGAGCTGGG - Intergenic
1067231606 10:44415895-44415917 CAGGACATACACACAGACCAGGG - Intergenic
1067701328 10:48575097-48575119 CAGGAGCAAAAGAGAGAGCAGGG - Intronic
1068447461 10:57140532-57140554 CAGGAAAAACGAAAAAAGCATGG + Intergenic
1068450873 10:57186058-57186080 CAAGAAGACCAGAAAGAGCAAGG + Intergenic
1068658390 10:59597336-59597358 CAGTAGAGACAGAAAGAGCTAGG + Intergenic
1068926660 10:62546894-62546916 CAGGTCAGAAAGAAAGAGAAGGG + Intronic
1070568008 10:77618594-77618616 CAGGAGAACAGGAAAGAGCATGG + Intronic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071163745 10:82781052-82781074 CAGCACAAAGAGATACAGCATGG - Intronic
1071165958 10:82806879-82806901 TAGGACAAATAGAAATAGGAAGG - Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071941045 10:90592197-90592219 CAGGAAAAGCAGTGAGAGCATGG + Intergenic
1072076405 10:91978534-91978556 CTAGACAAAGAGAAAGAGAAAGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072602919 10:96947634-96947656 CAGGTAAAACAGTAAGATCAGGG + Intronic
1072728454 10:97829061-97829083 CTGCCCAGACAGAAAGAGCAAGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073134102 10:101210360-101210382 TAGGTCTAATAGAAAGAGCAGGG - Intergenic
1073260823 10:102188882-102188904 AAGGCCAAGCAGCAAGAGCAGGG + Intergenic
1073779307 10:106819764-106819786 CAGGAAGAACAGAAAGATAAGGG + Intronic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1073913914 10:108379670-108379692 CTTGTCCAACAGAAAGAGCAAGG + Intergenic
1073954083 10:108847911-108847933 CAAGAAATAAAGAAAGAGCAGGG + Intergenic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076386430 10:130060123-130060145 CAGGACAAACAAACAGGACAAGG - Intergenic
1076395507 10:130135589-130135611 CAGGAGACACAGGAAGTGCAAGG + Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1076934998 10:133562019-133562041 CAGGCCAAACTGAAAGAGAAAGG + Intronic
1077893144 11:6434052-6434074 GAGGACAATAAGAAAGAGAAAGG - Intronic
1078912062 11:15742003-15742025 TACCAAAAACAGAAAGAGCATGG - Intergenic
1079049702 11:17143319-17143341 CAGGTGAAAGATAAAGAGCATGG - Intronic
1079248361 11:18769766-18769788 TAGAGCAAATAGAAAGAGCAAGG + Intronic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080116138 11:28623321-28623343 CAGGACAGAAAGAAAGATCCCGG + Intergenic
1080364972 11:31563438-31563460 CAGTAAGAACAGAAAGAGCTTGG + Intronic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080524781 11:33104170-33104192 AAAGACAAACAGAAGTAGCAAGG + Intronic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083660331 11:64249082-64249104 GAGGACAGACAGAAAGGTCAGGG - Intergenic
1084911260 11:72391341-72391363 GCAGACAAAGAGAAAGAGCATGG - Intronic
1085016175 11:73175422-73175444 AAGGAAGAAAAGAAAGAGCAAGG + Intergenic
1085241798 11:75062642-75062664 CAGGAGCAAGAGAGAGAGCAAGG - Intergenic
1085804200 11:79619474-79619496 AAGGACACCCAGGAAGAGCAAGG - Intergenic
1086138817 11:83471580-83471602 TAGGAAAAACAAAAAGAGCTTGG - Intronic
1087190688 11:95251085-95251107 CAGGACATGTAGAAAGAGCCTGG + Intergenic
1087238255 11:95745750-95745772 CCAGACAAACATAAACAGCATGG - Intergenic
1088056872 11:105593259-105593281 CATGATAATCAGAAAGATCAAGG + Intergenic
1088972899 11:114788949-114788971 CATGCCAAATAGACAGAGCAAGG + Intergenic
1090742263 11:129675212-129675234 CAGAAAACACAAAAAGAGCAGGG + Intergenic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1091642088 12:2245089-2245111 CAGGCAAGACAGAAACAGCATGG + Intronic
1092017470 12:5171197-5171219 CAAGACAGAAAGAAAGAACAAGG + Intergenic
1092231760 12:6779701-6779723 CAAGACAGACAGACAGAGCAGGG - Intergenic
1092245752 12:6863448-6863470 CAGGAGAAACACAAAGGACAGGG - Intronic
1092680560 12:10975233-10975255 CCCTACAAACAGAAAGAGAATGG + Intronic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1094413739 12:30196024-30196046 CAGGAAAAAAAGAAAGAATAAGG - Intergenic
1094719509 12:33049019-33049041 CAGGAGGAAAAGAAAGAGAAAGG - Intergenic
1094724150 12:33095364-33095386 CAGGAAAGAGAGAGAGAGCAAGG + Intergenic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095460522 12:42439427-42439449 AAGAACAGACAGAAAGATCAAGG - Intronic
1096177520 12:49532762-49532784 CAGGACAGACAGAAAAGGAAAGG - Intergenic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096924646 12:55130139-55130161 GAGGGCAAAGAGAAAGAGCTGGG - Exonic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099033409 12:77557245-77557267 CAGGAGAAATAAAAACAGCAGGG - Intergenic
1099627777 12:85097323-85097345 CAGGAGAGAGAGAAATAGCAGGG + Intronic
1099641050 12:85284779-85284801 CAGAACACACACAAAGACCAAGG - Intronic
1100899748 12:99224503-99224525 CAGGACCAAGAGAGAGAGAAGGG - Intronic
1101255248 12:102970936-102970958 CAGCACAAACGGAAAGAGACTGG - Intergenic
1101626265 12:106445110-106445132 GAAGACAAAGAGAAAGAGGAAGG - Intronic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1102952135 12:117038088-117038110 CAGGACTGCCAGAAAGAGCCAGG + Intergenic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1105326655 13:19376508-19376530 CCAGACAAACAGGAAGAGCTAGG + Intergenic
1105500700 13:20969131-20969153 CAGGAAGAAAAGAAAGAACATGG + Intergenic
1106139400 13:26998995-26999017 CCAGGAAAACAGAAAGAGCAGGG + Intergenic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1107042627 13:35965972-35965994 GAGGAAAAACAGAAAGCTCAAGG + Intronic
1107754324 13:43603210-43603232 CATGACATATTGAAAGAGCATGG - Intronic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1107934875 13:45337513-45337535 AAAGACAGACAGAAAGCGCAGGG + Intronic
1108067597 13:46594199-46594221 CAGGCAAAACAGTAAGAACATGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108232127 13:48356828-48356850 CATGTCAAACATAAAGAACATGG - Intronic
1109157717 13:58931358-58931380 CAGAACAAGCAGAAAAAGAATGG + Intergenic
1109253577 13:60050391-60050413 AAGGACAGACAGAAAAGGCAGGG + Intronic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1110646946 13:77897610-77897632 AGGGAGTAACAGAAAGAGCAAGG - Exonic
1111643649 13:91002592-91002614 CAGGAACAACAGAAAGAGAAAGG - Intergenic
1112225761 13:97538313-97538335 CAGGACAAACAGGAAGAGTGTGG + Intergenic
1112235769 13:97634862-97634884 CAGGAGCAAGAGAGAGAGCAAGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1116162879 14:41291777-41291799 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118424936 14:65650474-65650496 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1118841389 14:69515680-69515702 CAGGAGCAAGAGAGAGAGCATGG + Intronic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121150452 14:91628616-91628638 CAGGAGAAAGAGACAGTGCAGGG - Intronic
1121170800 14:91852733-91852755 CAAGAGAAAGAGAAAGAGAAGGG + Intronic
1121284493 14:92724763-92724785 CAGTACAAGCAGACAGAGTAGGG - Intronic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121883540 14:97522290-97522312 CAGGAAAAACCAAAAGAGAAAGG - Intergenic
1122246171 14:100404953-100404975 CAGGAAAGACAGAACTAGCATGG - Intronic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1124119042 15:26872758-26872780 AAGGAAAAAGAAAAAGAGCAGGG + Intronic
1124160961 15:27269386-27269408 CAGCACACACAGAAAGCACAGGG - Intronic
1125025449 15:35024854-35024876 CAAGACAAAGAAAAAGAGCTCGG - Intergenic
1125185125 15:36921274-36921296 CAGGACCAAAAGAAGCAGCATGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126863535 15:52912441-52912463 GAGGATAAACAGAAAGCACAGGG - Intergenic
1126932490 15:53670508-53670530 CTGGACAGATAGAAAGAACATGG - Intronic
1127064439 15:55222342-55222364 CAGGAAAAACACATAGAGTAGGG - Intronic
1127254079 15:57273604-57273626 TAGGAAAGACATAAAGAGCAGGG - Intronic
1127370170 15:58331834-58331856 CAGGACAAACAGGGAGGGGAGGG - Intronic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129366972 15:75062202-75062224 CATGACTCACAGAAAGAGCAAGG - Intronic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130830207 15:87591574-87591596 CATGACAGAAAGACAGAGCAAGG - Intergenic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1131695074 15:94868176-94868198 CAGGAAAAAGAAAGAGAGCAAGG + Intergenic
1131863359 15:96678461-96678483 CAGAACAACCAGAAATAGAAAGG + Intergenic
1131937776 15:97525773-97525795 GAGGAAAAAAAGAAAGAGAAGGG + Intergenic
1132259749 15:100412401-100412423 AAAGACAAACATAAAGACCATGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133590062 16:7233420-7233442 CATGAATAAGAGAAAGAGCAAGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1134905639 16:17977418-17977440 CAAAACCAACAGAAAGAGCAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135911396 16:26564749-26564771 CAAGAAGAAGAGAAAGAGCAAGG - Intergenic
1138211500 16:55166900-55166922 ATGGACAAAAAGAAATAGCAAGG + Intergenic
1138442440 16:57043155-57043177 CAGGACAAAATGAAAATGCAGGG - Intronic
1138549825 16:57741511-57741533 CAGGACCAGCAGACAGGGCAGGG - Intronic
1139368422 16:66448402-66448424 CAGGAAAAAAAGAAAAAGAAAGG - Intronic
1140052876 16:71498296-71498318 CAGGACCAAGAGAGAGAGCGGGG - Intronic
1140570453 16:76099730-76099752 TAAGAAAAACAGAAAAAGCATGG - Intergenic
1140716086 16:77726963-77726985 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1140959825 16:79901027-79901049 CAAGAAATACAAAAAGAGCAAGG - Intergenic
1141284907 16:82662603-82662625 CAGGACATTCAGGAAAAGCAGGG - Intronic
1141492694 16:84385234-84385256 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1141656829 16:85421151-85421173 CAAGAGAAACAGGAAGGGCAGGG + Intergenic
1141707240 16:85673495-85673517 CAGTACAAACACTAAAAGCAAGG - Exonic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1146348440 17:32076199-32076221 AAGGAGCAAGAGAAAGAGCAGGG - Intergenic
1147585541 17:41652338-41652360 CAGGACACAGACACAGAGCAGGG + Intergenic
1147649794 17:42055378-42055400 CAGGACCACCAGGAAAAGCAAGG - Intronic
1148743972 17:49908249-49908271 CAGGACAGGGAGACAGAGCAGGG + Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149352585 17:55806162-55806184 CAAGAAAAACAGAAAGAGAGGGG + Intronic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1150050837 17:61961017-61961039 AAGGACAAACAGACAGAGCTAGG - Exonic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151009267 17:70474525-70474547 CAGGAGACAGAGAGAGAGCAAGG + Intergenic
1151532918 17:74718935-74718957 CAGGAAAAACATAAAAAGTATGG + Intronic
1152213364 17:79017069-79017091 CAGGAGAAAGAGAGAGAGCGAGG + Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153486091 18:5599646-5599668 CAGGAGCAAGAGATAGAGCAAGG - Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155476046 18:26236739-26236761 CAGGACGAAAAGGAAAAGCAAGG - Intronic
1155479449 18:26269284-26269306 CAGGACAAACCCATAGATCAAGG - Intronic
1155594515 18:27469759-27469781 CAGCAAAAACAGCAAAAGCAGGG - Intergenic
1155889124 18:31244569-31244591 CAGCACACACAAAAAGACCAGGG - Intergenic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1156953317 18:42931555-42931577 CAAGTCAAATAGAAAGAGGAAGG - Intronic
1157815681 18:50728130-50728152 CAGGCCCAACAGATAGACCAAGG - Intronic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1158749762 18:60245127-60245149 CAGGACAAATAGCTAAAGCATGG + Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1160274190 18:77415392-77415414 AAGGACAAAGAGAAAGAACGAGG - Intergenic
1160611042 18:80085331-80085353 CAGGAACAAGAGAGAGAGCAAGG - Intronic
1161497722 19:4596736-4596758 CTGGACAAACAGCAAGAAAATGG + Intergenic
1162316059 19:9938695-9938717 CAGGTCAATGAGAAAGAGCTTGG + Intergenic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1164919348 19:32077252-32077274 CAGGACAAAGAGAAAGAATGTGG + Intergenic
1166690094 19:44817340-44817362 CAAGAAAAACAGCAAGAGAACGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
925345471 2:3169007-3169029 CAGGAATAAGAGAAAGAGAAGGG + Intergenic
925903815 2:8527243-8527265 GAGGCCAGACTGAAAGAGCAGGG + Intergenic
926629414 2:15123169-15123191 AAGGAGAAACTGAGAGAGCATGG - Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
928064039 2:28145205-28145227 AAGCACAGACAGAAAGAGCTGGG + Intronic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929123654 2:38503592-38503614 AAGGGCAAAAGGAAAGAGCAAGG - Intergenic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930214434 2:48680168-48680190 CACGAAAAACAGAAAAAGTAGGG - Intronic
930623631 2:53670691-53670713 CTGGAGAAACAAAAAAAGCAAGG + Intronic
930864094 2:56105880-56105902 CAGGAAGAAGAGAGAGAGCAGGG + Intergenic
931311476 2:61085204-61085226 CAGGACATACAAAAAAAGTATGG - Intronic
931389556 2:61829354-61829376 CAGGAGAACCTGAAATAGCAAGG + Intronic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
932481905 2:72046787-72046809 CAGGGAAAACAGAAAGCACAAGG + Intergenic
932634243 2:73373997-73374019 CAGGACCAAGAGCAAGAGAAGGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
933914643 2:86977279-86977301 CAGAAGTAATAGAAAGAGCATGG + Intronic
934008350 2:87792620-87792642 CAGAAGTAATAGAAAGAGCATGG - Intronic
934568209 2:95352333-95352355 CAGGTCAGGGAGAAAGAGCAGGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935407757 2:102726861-102726883 CAGGACAAACAGAAACACATTGG + Exonic
935427004 2:102930034-102930056 TGGCACAAAGAGAAAGAGCAGGG - Intergenic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
935771992 2:106433561-106433583 CAGAAGTAATAGAAAGAGCATGG - Intronic
935908077 2:107862384-107862406 CAGAAGTAATAGAAAGAGCATGG + Intronic
935994484 2:108754615-108754637 CAGAAGTAATAGAAAGAGCATGG + Intronic
936129867 2:109827491-109827513 CAGAAGTAATAGAAAGAGCATGG + Intronic
936214830 2:110543994-110544016 CAGAAGTAATAGAAAGAGCATGG - Intronic
936249740 2:110859185-110859207 CAAAACAAAGAGAAAGAGAATGG + Intronic
936423967 2:112398557-112398579 CAGAAGTAATAGAAAGAGCATGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
936736054 2:115445075-115445097 CAGGAAAGAGAGAGAGAGCAGGG - Intronic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
937084420 2:119161240-119161262 AAAGACAAAAAGACAGAGCAGGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937884464 2:126890376-126890398 CAGCAGAGACAGAAACAGCAGGG - Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939046734 2:137258658-137258680 CAGAAAAAAAAAAAAGAGCATGG - Intronic
939286127 2:140132491-140132513 CAAGAGAAACAGAAAGTTCAAGG + Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940328318 2:152448932-152448954 CTCGACAAACACAAAGTGCATGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940698370 2:157009484-157009506 CAGGAAAGAGAGAAAGTGCAGGG - Intergenic
940953159 2:159699540-159699562 GAGGACAAAAAAAAAGAGCTGGG + Intergenic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941553893 2:166951387-166951409 CAGGAGAAACAGAGAGATAAAGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942677649 2:178445659-178445681 CAGGCTATACAGAAACAGCATGG + Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943729164 2:191283723-191283745 CAGGACTATCATTAAGAGCATGG - Intronic
943737823 2:191376687-191376709 CAGTCCAAACACAAAGACCATGG - Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946906972 2:224426841-224426863 CAGGAAAGAGAGAAAGAGAAGGG - Intergenic
947466540 2:230354106-230354128 CAGGAGAAACAGAAATATTATGG - Intronic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
948152792 2:235757545-235757567 CAGCACAAACATAAAAAGCCAGG - Intronic
948845870 2:240682595-240682617 CAGGAAGAGCAGGAAGAGCAGGG + Exonic
948847989 2:240692135-240692157 CAGGAAGAGCAGGAAGAGCAGGG - Exonic
1168870120 20:1120401-1120423 CAGCACAAAGAGAAAGGTCAGGG - Intronic
1168872291 20:1140245-1140267 TAGGATAAACATATAGAGCAAGG + Intronic
1168902470 20:1376775-1376797 CTGGAATAATAGAAAGAGCATGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170129470 20:13003063-13003085 CAGGAAAGAGAGAGAGAGCAGGG + Intergenic
1170182053 20:13542922-13542944 CAAGACAAACACAAAGAAAAAGG + Intronic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1170912467 20:20587150-20587172 AAGGACAAACAAAAACAGCAAGG + Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1172937377 20:38629869-38629891 AAGGATAAAAACAAAGAGCATGG - Intronic
1173304586 20:41836131-41836153 CAGGACACAGAGAAAGATGAAGG - Intergenic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174791819 20:53485703-53485725 CAGCACAAAAAAAAAAAGCATGG + Intronic
1174978564 20:55363716-55363738 CAGGAGAAACAGAAACTGCCAGG + Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175825157 20:61932985-61933007 CATGACAAACAGCAGGACCATGG - Exonic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176886771 21:14265807-14265829 CAGGAGAAACAGAGAGAGAGCGG - Intergenic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1179055876 21:37933602-37933624 CAGGAGAAAGAGAGAGAGTAAGG - Intergenic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180058994 21:45375129-45375151 AAGGACAGACAGAAAGAGGTCGG + Intergenic
1183291061 22:37002309-37002331 CAGGACAAAGAGAAACAGAGGGG + Intronic
1183425846 22:37739056-37739078 CAGGCCAGGCTGAAAGAGCAGGG + Intronic
1183691309 22:39390124-39390146 CAGTACAAAATGAAAGTGCAGGG + Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
1185092882 22:48785857-48785879 CAGTACAAACAGACAGGCCAAGG + Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949134273 3:543750-543772 CAAGATAAACAGAAACAGAATGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949270595 3:2211967-2211989 AAGGAAAAAAAGAAAGAGAAAGG - Intronic
950519345 3:13487323-13487345 CAGCACACACAGAATGACCAGGG - Intronic
950860423 3:16142918-16142940 CAGGAAAAACAGAAAGGAAATGG + Intergenic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
951545841 3:23824285-23824307 CAGGACACAGAGACAGAGAAGGG - Intronic
951800519 3:26590631-26590653 CAGGAAAAAGAGAAAGAGAAGGG - Intergenic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953591945 3:44266052-44266074 AAGGTCAAACAGGAAGTGCAAGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
955622184 3:60876880-60876902 CAGGACAGCCACAAAGAGAATGG + Intronic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956192843 3:66623487-66623509 CATGACAAAGAGAAAGAGAGAGG + Intergenic
956342527 3:68241857-68241879 CAGGACTAACAGAAAGCGCAGGG + Intronic
957406819 3:79782519-79782541 TAGGACAAAGAGAAAGGCCATGG + Intergenic
957909297 3:86601692-86601714 TAGAACCATCAGAAAGAGCATGG - Intergenic
958090131 3:88866880-88866902 AATGAGAAACAGAGAGAGCATGG + Intergenic
958121375 3:89293674-89293696 CAGAAAAGAGAGAAAGAGCAAGG - Intronic
959354072 3:105303471-105303493 TAGGCCAAAAAGAAAGAGAAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
961115252 3:124323682-124323704 CAAGAAAAGCAGTAAGAGCAAGG - Intronic
962121618 3:132566379-132566401 CAGGAAGAAGAGAAAGAGTAAGG + Intronic
962127665 3:132639153-132639175 CAGAAAAAACAGCAAGAACATGG + Intronic
962197738 3:133378386-133378408 CAGGACAAACGGCCAAAGCAGGG - Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
963258935 3:143175091-143175113 CAGGATTAAGAGAACGAGCAGGG + Intergenic
963353163 3:144177336-144177358 AAGCAAAAACAGAAAAAGCAAGG - Intergenic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG + Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966572093 3:181455095-181455117 CAGGAAAAAAAAAAAAAGCATGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
968146391 3:196302680-196302702 CAGCCCACACTGAAAGAGCAGGG - Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969835861 4:9840914-9840936 GAGGACAAAGAGAGAAAGCAGGG + Intronic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970704294 4:18782128-18782150 CAGGAGAAAGAGAGATAGCAGGG + Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971172073 4:24243582-24243604 CATGGCAAATAGAAAGAGTAGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975650195 4:76585386-76585408 CAGCACACACAGAAAGAAAATGG - Intronic
975768706 4:77697823-77697845 AATGACACACAGATAGAGCAGGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976703254 4:87993879-87993901 TAGTACACTCAGAAAGAGCATGG - Intergenic
978226913 4:106347021-106347043 CAGGACCAAGAGAGAGAGCGGGG + Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979632207 4:122916130-122916152 CAGCAAAAACAGAAACAGCCAGG + Intronic
980771139 4:137374554-137374576 CACTATAATCAGAAAGAGCATGG + Intergenic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
982096317 4:151926673-151926695 CAATGCAGACAGAAAGAGCAGGG - Intergenic
982570998 4:157050614-157050636 CAGGACTAAGAGATAGAGCGGGG + Intergenic
983081863 4:163395962-163395984 GAAGACAAACAGAAAGTGAAAGG - Intergenic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983632509 4:169863613-169863635 AAGGACAAGCAGAGAGGGCAAGG - Intergenic
983967580 4:173831819-173831841 CAGGTCACAGAGCAAGAGCAGGG + Intergenic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984984712 4:185316751-185316773 CAGTATCAACAGAAAGAGCCAGG - Intronic
985810913 5:2084181-2084203 CCTGACAAACAGAAATAACATGG + Intergenic
986120552 5:4831814-4831836 CAGGAAAAACAGAAACTACAAGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986457769 5:7937348-7937370 CAGGAGTAAGAGAGAGAGCAGGG - Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987521538 5:18991631-18991653 CTTGACAAAAAGAAAAAGCAAGG + Intergenic
988580012 5:32460632-32460654 CAGGACAGAGAGAAAGAGCAGGG + Intergenic
988580063 5:32460945-32460967 CAGGAGCAAAAGAGAGAGCAGGG - Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989102077 5:37832924-37832946 TAGGACAAACATAAAGGCCAAGG + Intronic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
989758309 5:44983151-44983173 CAGGAGGATCAGAAAGACCATGG + Intergenic
989763422 5:45048997-45049019 CAGCAAAAACAGAAAATGCATGG - Intergenic
990004418 5:50929333-50929355 CAAGACAAAAAGAAAGAGAAAGG - Intergenic
990133633 5:52618917-52618939 CAGGACAAAGAGAGAGAACTGGG - Intergenic
991966240 5:72094299-72094321 CAGCCCAAACAGAAACAGCATGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992632071 5:78691196-78691218 AAGAACAAATAGAAAGAACAAGG + Intronic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
993814412 5:92523596-92523618 CAGCCCACACATAAAGAGCAGGG - Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994957163 5:106546741-106546763 CTAGACAAACAGAAAGCACAAGG - Intergenic
996074062 5:119168866-119168888 CAAGACAAAAGGAAAGAGGAAGG - Intronic
996494670 5:124140075-124140097 CAGGAAATACAGACAGAGCTTGG + Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
998220656 5:140275924-140275946 CATGATAAATAGAAATAGCATGG + Intronic
998614828 5:143728397-143728419 AAGGGCCAACAGAAAGAGAAAGG - Intergenic
998630511 5:143892882-143892904 CAGAGCTAACAGAAACAGCAAGG - Intergenic
999194324 5:149771712-149771734 CTAGGCAAACAGAAAGAACAAGG - Intronic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1001303918 5:170557564-170557586 CAAGACAAACAGTTAGAGGATGG + Intronic
1001536970 5:172504870-172504892 GAGGAGAAACAGAAAATGCAGGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002462751 5:179383828-179383850 CAGCACAAAGGGAAAGGGCAAGG - Intergenic
1003618532 6:7676571-7676593 CAAGACAAACAGACATAGGAAGG - Intergenic
1003935800 6:10973964-10973986 GAAGACGAAGAGAAAGAGCAAGG + Exonic
1003968491 6:11276643-11276665 CAGGACCTCCAGAAAGAGCTGGG - Intronic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1004282714 6:14294511-14294533 CTGGACAAACATCAAGAGAAGGG - Intergenic
1004563245 6:16771330-16771352 AAGGAGAATCAGAAAGACCAAGG - Intergenic
1004597725 6:17116344-17116366 GAGGACAAATAGAAAGTTCAGGG - Intronic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005403515 6:25460441-25460463 CAGAACAAACATGAAGACCAAGG - Intronic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006416339 6:33906325-33906347 GAAGACAACCTGAAAGAGCAAGG - Intergenic
1006599213 6:35214438-35214460 CAGGACAAGCAGGCAGAGCCCGG - Exonic
1007091729 6:39189062-39189084 CAGGACAACCAGCAACAACATGG + Exonic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1008113269 6:47517131-47517153 CAGGAACAAGAGAAAGAGGAGGG - Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008822448 6:55650473-55650495 CAGCACAAACAGAGAGAGAGAGG - Intergenic
1008877416 6:56344795-56344817 CAGGAGGAAAAGAAAGAGAAGGG - Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1009033372 6:58087159-58087181 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009208985 6:60838928-60838950 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009531733 6:64826270-64826292 CATAACAAAAAGAAAGAACATGG - Intronic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011712678 6:90070474-90070496 CAGGCCAAGCAGACACAGCATGG + Intronic
1011859408 6:91736550-91736572 CAGATAAAACAGCAAGAGCATGG + Intergenic
1011976219 6:93302783-93302805 GAGGACAAACTGGAACAGCATGG + Intronic
1012153321 6:95783557-95783579 CAGGAGAGAGAGAAAGGGCAGGG + Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012865303 6:104611467-104611489 CAGGACAGAGAGAAAGTCCAGGG + Intergenic
1012961038 6:105621930-105621952 CAGGATAAAGAGAAAGCGCCAGG - Intergenic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1013315594 6:108939474-108939496 CAGGAAGAAGAGAGAGAGCAGGG - Intronic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1013863841 6:114669814-114669836 CAGGACAAAGAGAGAGTGAAGGG + Intergenic
1014334486 6:120115882-120115904 CAGGAAAAATAGAAACAGAATGG - Intergenic
1014340413 6:120198491-120198513 CAGGACACACATACAGATCAGGG - Intergenic
1014500594 6:122184234-122184256 CAGGACAAATAAAAAGATCCTGG - Intergenic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1014901761 6:126974253-126974275 CAAAACAAACAGAGAAAGCAGGG + Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1016026748 6:139295065-139295087 CAGGACAATGAGAAAGAATAGGG - Intergenic
1016470970 6:144374315-144374337 CAGTAGAGACAAAAAGAGCATGG + Intronic
1016792685 6:148082160-148082182 CTGGACTCACAGAAAAAGCACGG - Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018448335 6:163879380-163879402 AAGGACAGACAGAAAAAGAAAGG + Intergenic
1019190336 6:170247172-170247194 AGTGACAAACAGAAAGAACAGGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020355150 7:7267444-7267466 TAGGACAAAAAGAAAGAACCAGG + Intergenic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021037871 7:15823396-15823418 CAGGACAGATAAAAAGAGCAAGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021645787 7:22788285-22788307 CAGAACAAGCAAAAAGAGCCAGG + Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022029470 7:26479173-26479195 CAGAACAAACAGCAAGTGCAAGG - Intergenic
1022424402 7:30254418-30254440 CAAGACAAACAGAACAAGTAGGG - Intergenic
1023119861 7:36898616-36898638 CATGACCAACAGTGAGAGCAGGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1024818402 7:53297920-53297942 CCTGACAAACTGATAGAGCAGGG + Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1026562850 7:71464630-71464652 TTTGACAAACAGAAAGGGCACGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1027902568 7:84136298-84136320 TAGGACAAATAGATAAAGCAAGG - Intronic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1028579479 7:92391509-92391531 CAAGAAAAACAGAAATAGCATGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029897456 7:103999174-103999196 CAGGAAAAAATGAAGGAGCATGG - Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030699139 7:112619650-112619672 CAGGCCCAAGAGAAAGAGAAAGG - Intergenic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1030777409 7:113551905-113551927 TAGGACAAAAAGAAAAACCAAGG - Intergenic
1030854413 7:114535213-114535235 CAGGACAAACATAGTGAGTAAGG - Intronic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1030952038 7:115802799-115802821 CAAGACAGAGAAAAAGAGCAAGG - Intergenic
1031118446 7:117693511-117693533 CAGGACAACCAGAAAGAATTTGG - Intronic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031970615 7:128062393-128062415 GAGGACAAAAGGAAAGAGAAGGG + Intronic
1032784177 7:135187441-135187463 CAGGCCAGAGAGAAAGAGAAGGG - Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1034557717 7:151860535-151860557 CAAGACAGAGAGAGAGAGCACGG + Intronic
1034791829 7:153977534-153977556 CAGGACAAAAAGAAAGAATGAGG - Intronic
1035032969 7:155874499-155874521 GAAGAGAAACAGAAAGAGAAAGG + Intergenic
1035084864 7:156249405-156249427 CAGGCCCAACAGACAGCGCATGG - Intergenic
1035142754 7:156780270-156780292 CTGGACAAAAAGAAAGTGCTTGG + Intronic
1035297646 7:157876243-157876265 CAGGCCCAGCAGAAATAGCAGGG - Intronic
1035922719 8:3694784-3694806 CAGAAGTAACAGAAAGTGCAGGG + Intronic
1035936806 8:3850349-3850371 CAGGACAAAGAGAAAAGGCAAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036505958 8:9356293-9356315 GAAGGCAAAAAGAAAGAGCAGGG - Intergenic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1038754460 8:30327739-30327761 AAGGACAAAAAGAGAGGGCAAGG + Intergenic
1040560568 8:48520116-48520138 CAAGACAAACTAAAATAGCAAGG + Intergenic
1041005963 8:53497266-53497288 CAGGACAATGAGACAGGGCATGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042083160 8:65077987-65078009 AAAGACAAACAGAAATAGAAAGG + Intergenic
1042443326 8:68853063-68853085 CAGGACACACTGCAAGAGCCTGG - Intergenic
1043514095 8:80980167-80980189 CAGGAAAAATAGAGAGGGCAGGG - Intronic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044062675 8:87658327-87658349 CATGAGAAAAAGAAAAAGCAAGG + Intergenic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1045495248 8:102702606-102702628 CAGCACAAACAGATAAAGCTGGG - Intergenic
1046050436 8:109015196-109015218 CAAAAGAAACAGTAAGAGCATGG + Intergenic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1046214271 8:111122520-111122542 AAAGATAAACAGAAAGAGCAAGG + Intergenic
1047245296 8:123137691-123137713 AAGGTCAAACTGACAGAGCATGG + Intronic
1047304003 8:123638620-123638642 AAGGACAGAGAGAAAGATCATGG - Intergenic
1047340317 8:123974778-123974800 GAGGCCAAACAAAAAGACCAAGG + Intronic
1048005068 8:130412395-130412417 CAGGAGCAAGAGAGAGAGCAAGG - Intronic
1050397948 9:5219868-5219890 GAGGACAAAAACAAAGAACAAGG + Intergenic
1051149424 9:14064263-14064285 CAGGACACACAAAAAGAGAGGGG - Intergenic
1051748465 9:20317730-20317752 CCTGACACACAGAGAGAGCAAGG + Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1051923920 9:22299861-22299883 CACCACAGACAGAAACAGCATGG - Intergenic
1052558856 9:30057252-30057274 GAGCAAAAACAGGAAGAGCAAGG - Intergenic
1052784191 9:32813620-32813642 CAGGCCAAACAGAAGGCGCTAGG - Intergenic
1052913529 9:33905848-33905870 CAGGACAACTAGAAAGGTCAGGG + Intronic
1053089191 9:35258316-35258338 AAGGCAAAACAGAAAGAGAAAGG - Intronic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1054861783 9:69961243-69961265 AAGGACAAAGAGAGAGAGCGAGG - Intergenic
1055909201 9:81327614-81327636 CAAGACAGTCACAAAGAGCAGGG - Intergenic
1056637169 9:88340772-88340794 AAGGAAAAAGAGAAAGAGAAGGG - Intergenic
1056947346 9:91009980-91010002 CAGGAGCAAGAGAGAGAGCAGGG - Intergenic
1058217486 9:102253394-102253416 CAGCCCTAACAGAAAGAACATGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058344926 9:103949798-103949820 CATGAAAAAGAGAGAGAGCATGG - Intergenic
1058924410 9:109648115-109648137 CAGGACAGAGAGAAAGAGCAGGG - Intronic
1059136081 9:111807805-111807827 CAGGCCAAAGAGACAGATCAAGG - Intergenic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1060006099 9:120001178-120001200 TAATAGAAACAGAAAGAGCATGG - Intergenic
1060040343 9:120294973-120294995 CAGGAAAAACAAAAAGACCCAGG + Intergenic
1060688858 9:125638223-125638245 CAGGACAAACCAAAAGAGAGGGG + Intronic
1060777740 9:126388748-126388770 AAGGGCAAACAGAAAGCACAAGG - Intronic
1061087827 9:128409479-128409501 GAGGACAAAAAGGGAGAGCACGG + Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1185826365 X:3255100-3255122 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186886423 X:13918765-13918787 CAAGACCAAGAGAGAGAGCAGGG + Intronic
1187112928 X:16320023-16320045 CATGACAAAAAGAAAAGGCATGG + Intergenic
1187869537 X:23753087-23753109 CAGTACAAAAAGAAAGAAAAAGG + Intronic
1189463688 X:41262330-41262352 CAAGACACACAGAAAGGGAAGGG - Intergenic
1190888577 X:54550429-54550451 GAGCACATACAGAAAGAGAACGG + Intronic
1191612842 X:63135474-63135496 CAAACCAAACTGAAAGAGCAAGG + Intergenic
1191623455 X:63243452-63243474 CAAACCAAACTGAAAGAGCAAGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191748957 X:64520521-64520543 CATGAAAAACTGAAAGATCATGG + Intergenic
1192321407 X:70093355-70093377 TAAGATAAACTGAAAGAGCATGG - Intergenic
1192527956 X:71863762-71863784 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1193198420 X:78659879-78659901 CAGGACATTCAGAAAGAGCCAGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195105252 X:101597297-101597319 CAAGAAAAACAAAAAGAGCGTGG + Intergenic
1195461320 X:105128655-105128677 CAGAAGAAAAAGAAAGAACACGG - Intronic
1195470483 X:105224110-105224132 CAGGACAAAAAAACAGAGGAAGG + Intronic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197600840 X:128526804-128526826 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199039935 X:143101179-143101201 CAGGACAGACATAAAGTTCAGGG - Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200803100 Y:7404322-7404344 CAGGAGAATGAGAAAGAACACGG - Intergenic
1202280237 Y:23177172-23177194 CAGAAAAAAAAGAAAGAACAGGG + Intronic
1202280966 Y:23188019-23188041 CAGAAAAAAAAGAAAGAACAGGG + Intronic
1202436598 Y:24844887-24844909 CAGAAAAAAAAGAAAGAACAGGG - Intronic
1202605153 Y:26633118-26633140 CCAGACAAACAGGAAGAGCTAGG - Intergenic