ID: 1153469526

View in Genome Browser
Species Human (GRCh38)
Location 18:5428299-5428321
Sequence GTGGGTATACTTACCTCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153469521_1153469526 -2 Left 1153469521 18:5428278-5428300 CCTCCCAACGCACAGGCAAATGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 101
1153469525_1153469526 -6 Left 1153469525 18:5428282-5428304 CCAACGCACAGGCAAATGTGGGT 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 101
1153469523_1153469526 -5 Left 1153469523 18:5428281-5428303 CCCAACGCACAGGCAAATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153469526 Original CRISPR GTGGGTATACTTACCTCTCC CGG Exonic
902956072 1:19924791-19924813 GTGGGTTTAGTCTCCTCTCCTGG - Intergenic
905850872 1:41273761-41273783 GTGGGTCACCTCACCTCTCCGGG - Intergenic
906320168 1:44810690-44810712 GTGGGCACACGTTCCTCTCCAGG - Intronic
909433062 1:75612248-75612270 TTGGGGATACATTCCTCTCCTGG - Intergenic
914485756 1:148107951-148107973 GTGGGTAAACTTCCCTATTCTGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1065842553 10:29715165-29715187 GTGGATATACTCACCTTGCCTGG - Intronic
1073986537 10:109216021-109216043 GATGGTATACTTACCTCTAGTGG - Intergenic
1074221462 10:111442369-111442391 GTGGGGATACTTTCCTATGCTGG - Intergenic
1079225735 11:18603187-18603209 GAAGGTACACTTACCCCTCCTGG - Intergenic
1080473692 11:32570538-32570560 GTGGGTATGTTTTCCTTTCCTGG + Intergenic
1089096087 11:115921146-115921168 GAGGCTATACTTCCCTCTCAGGG + Intergenic
1089656111 11:119948104-119948126 GTGGTTTTACTTCCCTCCCCGGG + Intergenic
1101514395 12:105420831-105420853 GTGGGGATACTGCCCTCTGCAGG - Intergenic
1107181586 13:37467343-37467365 GTGGGTATATATACCAGTCCAGG - Intergenic
1108643221 13:52402511-52402533 GTGAGTATACTTAACGCTACTGG - Intronic
1118243995 14:64090275-64090297 GTTAGGATACTTACCTCTCGAGG + Intronic
1119140656 14:72264493-72264515 GTGAGAGTACTTTCCTCTCCCGG - Intronic
1120612369 14:86658022-86658044 TTGGGTATCCTAATCTCTCCAGG + Intergenic
1121713531 14:96056578-96056600 GTGGGGATAATGACCTCTCCTGG + Intronic
1202894297 14_KI270722v1_random:189449-189471 GGGTGAATACTTACCTCTACAGG - Intergenic
1127850777 15:62910148-62910170 GTGGGATCACTTACCTCTCTGGG - Intergenic
1128721982 15:69956829-69956851 ATGGGAATACTTACCTGGCCAGG - Intergenic
1128819020 15:70635563-70635585 GTGGGAATTCAGACCTCTCCTGG - Intergenic
1132855270 16:2042146-2042168 GTGGAAATACCTCCCTCTCCAGG - Intronic
1140250742 16:73292283-73292305 GTGGGTATAGATATTTCTCCAGG + Intergenic
1140775397 16:78244560-78244582 GTTGGTAAATTTACCTTTCCTGG + Intronic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1146568783 17:33935675-33935697 GAGGGTATAAATCCCTCTCCTGG + Intronic
1149252828 17:54789726-54789748 GTGGGTTTAATAAACTCTCCCGG + Intergenic
1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG + Exonic
1157409464 18:47451613-47451635 ATGGGTATGCTTGTCTCTCCAGG - Intergenic
1157438805 18:47694152-47694174 GTGAGTACACTTAGCCCTCCTGG + Intergenic
1161627396 19:5335258-5335280 GTGGGTAAACATGCCTCCCCTGG - Intronic
1166935858 19:46332144-46332166 GTGGGAATAGTTACATCTCACGG + Intronic
927730220 2:25464548-25464570 GTGTAGATACTTCCCTCTCCAGG + Intronic
930245846 2:48982554-48982576 GTGGGTGAATTAACCTCTCCAGG + Intronic
940016867 2:149115696-149115718 GTGGGTCTAGTCACCTCTTCTGG - Intronic
940625451 2:156169749-156169771 GTGTCTATACTTTCCTCTCTAGG - Intergenic
948972036 2:241436277-241436299 GTGTGTAATCTTACCTCTCTTGG + Intronic
1169011543 20:2255330-2255352 GTGGGTGGCCTTATCTCTCCAGG - Intergenic
1172933056 20:38599836-38599858 GTGGGTACACTCACTTCTCCAGG + Intergenic
1182108734 22:27707645-27707667 CTTGGTCTCCTTACCTCTCCAGG - Intergenic
1185410590 22:50679468-50679490 GTGCATATACTTGCCTCTTCTGG + Intergenic
1185410603 22:50679553-50679575 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410615 22:50679643-50679665 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410623 22:50679729-50679751 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410635 22:50679819-50679841 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410646 22:50679907-50679929 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410656 22:50679995-50680017 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410676 22:50680171-50680193 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410688 22:50680259-50680281 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410704 22:50680435-50680457 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410715 22:50680521-50680543 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410727 22:50680609-50680631 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410743 22:50680785-50680807 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410754 22:50680871-50680893 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410765 22:50680957-50680979 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410776 22:50681043-50681065 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410780 22:50681131-50681153 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410791 22:50681219-50681241 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410801 22:50681305-50681327 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410812 22:50681393-50681415 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410829 22:50681573-50681595 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410841 22:50681663-50681685 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410852 22:50681749-50681771 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410863 22:50681837-50681859 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410874 22:50681923-50681945 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410885 22:50682011-50682033 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410895 22:50682097-50682119 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410905 22:50682185-50682207 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410916 22:50682273-50682295 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410927 22:50682359-50682381 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410939 22:50682447-50682469 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410950 22:50682535-50682557 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410961 22:50682623-50682645 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410973 22:50682711-50682733 GTGGATATACTTGCCTGTTCTGG + Intergenic
1185410985 22:50682799-50682821 GTGGATATACTTGCCTGTTCTGG + Intergenic
956080735 3:65552937-65552959 GAGGATATAATTCCCTCTCCTGG - Intronic
956175956 3:66473273-66473295 GTGGGTGTAACTACCTTTCCAGG + Intronic
962444196 3:135450286-135450308 GTGTGTCTACATACCCCTCCTGG - Intergenic
971864089 4:32146186-32146208 GTGGGTAGTCTGCCCTCTCCTGG - Intergenic
972344420 4:38180929-38180951 ATGGGTTTGCTTACTTCTCCAGG - Intergenic
975788046 4:77915090-77915112 GTGTGTCTACTTACCTGTACAGG + Intronic
980708776 4:136536877-136536899 GTGTGGATACTTTCCTCTACTGG + Intergenic
980921105 4:139086793-139086815 GTGGGTATAATTACCACCCAAGG + Intronic
981850009 4:149218862-149218884 GTTGGTCTGCTGACCTCTCCAGG + Intergenic
983265002 4:165499493-165499515 GTAGGTCTACGTAACTCTCCAGG + Intergenic
987077909 5:14401680-14401702 TTGATTATACTAACCTCTCCTGG + Intronic
995519149 5:112984419-112984441 TTGGGTATGGTTATCTCTCCAGG - Intronic
1016252074 6:142055668-142055690 GTGCGTATACCTACCTCTAAGGG - Intergenic
1022100429 7:27166171-27166193 GCGGGTAAACTCGCCTCTCCCGG - Intronic
1025630689 7:63270049-63270071 ATGGCTATCCTTACCTCTCTGGG + Intergenic
1030947857 7:115748317-115748339 GTTGCTATACTGACCTCTGCAGG + Intergenic
1041861391 8:62517353-62517375 GTGGGTATAGGTAACTCTCTAGG + Intronic
1042090540 8:65154408-65154430 GTTGGTATATTTCCCTCTCTAGG + Intergenic
1045681283 8:104663082-104663104 GTGGGTATAATTATCTCTTATGG + Intronic
1046058580 8:109108543-109108565 TAGGGTATGGTTACCTCTCCTGG - Intronic
1048333507 8:133486750-133486772 GTGGGTGTTCTCTCCTCTCCTGG - Intronic
1057257148 9:93558710-93558732 GTGGGTATAATTACCGCCCTGGG - Exonic
1057902987 9:98963995-98964017 GTGGCAATACTTAGCTCTCAGGG - Intronic
1061711236 9:132489396-132489418 GGGGTTAAACTCACCTCTCCTGG - Intronic
1192085997 X:68097952-68097974 GTTGTTATTATTACCTCTCCAGG + Intronic
1196112332 X:111960361-111960383 GTGGTTATACAAACCTCCCCTGG - Intronic