ID: 1153470460

View in Genome Browser
Species Human (GRCh38)
Location 18:5438812-5438834
Sequence AGGCCTCTCCAGCACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153470458_1153470460 -6 Left 1153470458 18:5438795-5438817 CCTGTGGCCTCTACTCAAGGCCT 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 161
1153470455_1153470460 19 Left 1153470455 18:5438770-5438792 CCTCTTTATGCTTTGCAATCTTT 0: 1
1: 0
2: 0
3: 26
4: 376
Right 1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 161
1153470454_1153470460 25 Left 1153470454 18:5438764-5438786 CCAGATCCTCTTTATGCTTTGCA 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153470460 Original CRISPR AGGCCTCTCCAGCACTGAAA AGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903141935 1:21344479-21344501 CGGCCTCTCCATCACGGGAAGGG - Intronic
903246122 1:22016768-22016790 AGCCCTCTCAACCACTGAATGGG - Intergenic
907329079 1:53659673-53659695 AAGGCTCTGCAGCACTGAGAAGG + Intronic
909542590 1:76807424-76807446 AAGCCTCTGCAGCACCCAAATGG + Intergenic
916117057 1:161494552-161494574 AGGCTCCTCCAGCCCTGAAGGGG - Intergenic
922723064 1:227908665-227908687 AGGTCTTTCCAGGACTCAAAGGG - Intergenic
924155966 1:241176896-241176918 CTGCCTTTCCAGCACTAAAATGG + Intronic
1065676391 10:28179059-28179081 AGATGTCTCCAGGACTGAAAAGG + Intronic
1067059762 10:43072231-43072253 AGGTCCCTCCAGCACTGAGAAGG + Intergenic
1067208862 10:44242144-44242166 AGAGCTCTCCTGCACTGAAGGGG - Intergenic
1067656646 10:48197399-48197421 AGGACACTCCAGCTCTGAAAGGG + Intronic
1068493007 10:57747695-57747717 AGGCTTCACTAACACTGAAATGG - Intergenic
1068954962 10:62813925-62813947 AGGTCTCTCTGGCACTGAGATGG + Exonic
1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG + Intronic
1071457738 10:85863698-85863720 GGGCCTCTCCCCCACTGATAGGG - Intronic
1071742199 10:88372170-88372192 AGGCCTTTGCAGCATTGTAAAGG + Intronic
1076446561 10:130518226-130518248 AGGTCTCTCCTGCACTGAAACGG + Intergenic
1076832947 10:133006089-133006111 AGGACTTTCCTGCACTGAATTGG - Intergenic
1079328276 11:19512729-19512751 AACCCTCTCCAGCACTGACAAGG - Intronic
1082753629 11:57049600-57049622 AGGCCACTCTATGACTGAAATGG + Intergenic
1083276809 11:61601554-61601576 GGGCCTCTCCAGCTCTGACACGG + Intergenic
1084097696 11:66922764-66922786 AGGCTTCTGCATCACTGAGATGG + Intronic
1084143757 11:67252075-67252097 AGGCCAGACCAGAACTGAAAGGG - Intronic
1085304248 11:75476236-75476258 CAGCCTCTCCATCTCTGAAATGG - Intronic
1090948178 11:131449750-131449772 AGGCCTCTCCAGTCCTGCATGGG - Intronic
1090958259 11:131533439-131533461 AGACGTCTCCATCACTGAAATGG + Intronic
1092496164 12:8997220-8997242 CGCCCTCTCCAGCACTGACTTGG - Intronic
1092517870 12:9234613-9234635 AGGCATCTCCAGCAAAGCAATGG + Intergenic
1095241914 12:39870426-39870448 AGAGCTATCCAGCAATGAAATGG - Intronic
1096567849 12:52496235-52496257 AGGCCCCACCACCACTAAAAGGG + Intergenic
1096745993 12:53727258-53727280 TGGCTTCTCCAGTACGGAAAGGG + Intronic
1101098161 12:101365193-101365215 AGGCCTCACCAGCAGAGAACAGG + Intronic
1102202314 12:111066104-111066126 AGGCCTCTTCAGTACTAAGATGG + Intronic
1102628599 12:114256800-114256822 GGCCCTCCCCAGCACAGAAAGGG + Intergenic
1103568417 12:121828854-121828876 TGGCCTGGCCAGCACTCAAATGG - Intronic
1104102104 12:125622472-125622494 AGTCCTTTCCAGCACAGGAAAGG - Intronic
1104404326 12:128505051-128505073 AGGGCTCTCTAACACTGACAAGG - Intronic
1105871190 13:24507207-24507229 CGGCCTCGCCAGCTCAGAAAGGG + Intronic
1107832729 13:44388849-44388871 AGGCCTCTCCATTTCTGGAAGGG + Intronic
1109854744 13:68111736-68111758 AGGCCTCTCTACCTGTGAAAGGG + Intergenic
1111923180 13:94433850-94433872 GGGCCTCTCCAACAATCAAAGGG - Intergenic
1115711147 14:36052424-36052446 AGAACACTCCAGTACTGAAATGG + Intergenic
1116034141 14:39607713-39607735 AGGTCTCTCCTACACTGAAGGGG + Intergenic
1121320275 14:92988022-92988044 GAGCCTCCCCTGCACTGAAAGGG + Intronic
1121415066 14:93773754-93773776 TGCCCTCTCCAGCAATGAAGTGG + Intronic
1124610319 15:31203545-31203567 AGTCCTCTCCATCCCTGCAAGGG - Intergenic
1129227073 15:74176192-74176214 AGACCCCTGCAGCACTTAAAGGG - Exonic
1132901417 16:2256824-2256846 AGGGCTCTGCAGCACTGAGAGGG + Intronic
1132985397 16:2764094-2764116 AGGCCTATCCTGTACTGGAAAGG - Exonic
1133438458 16:5800515-5800537 AGGGCTCTCCAGCACAAATAAGG + Intergenic
1134102567 16:11462290-11462312 AGGTCACTCCAGCCCTGAAACGG + Exonic
1134259203 16:12637292-12637314 AGGCATTTACAGCACAGAAAGGG - Intergenic
1137427572 16:48392434-48392456 AGGCCTCTAGAAAACTGAAAAGG + Intronic
1137790732 16:51172575-51172597 AGTGCTCCCCAGCACTGAATAGG + Intergenic
1138103993 16:54277265-54277287 GGGCCTCACCAGCACTGAGGTGG + Intergenic
1139474576 16:67196589-67196611 AGCCCTCTCCAGGAGTGGAATGG - Intronic
1139811818 16:69625472-69625494 AGGCATCTCCAACCCTGGAAAGG - Intronic
1143755250 17:9062271-9062293 TGGCTTCTCCAGCCCAGAAAGGG - Intronic
1144563682 17:16342790-16342812 CTGCCTCTCCTGCCCTGAAAAGG - Exonic
1145771639 17:27497459-27497481 AGGCCATTCAAGGACTGAAAGGG - Intronic
1146461723 17:33051177-33051199 ATGCCTGTCCTCCACTGAAAGGG - Intronic
1150428196 17:65093969-65093991 AGGCCTCCCCAGAATTGAAGGGG - Intergenic
1150976349 17:70091415-70091437 AGGCCTCTCCTGCACTGTGTTGG - Intronic
1151990319 17:77570401-77570423 GGGCCTCTCCTGCCCTGCAAAGG + Intergenic
1153462557 18:5352721-5352743 AGGCCTCCTTATCACTGAAATGG + Intergenic
1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG + Intronic
1153938203 18:9950910-9950932 AGGGCTGTTGAGCACTGAAATGG + Intronic
1154092458 18:11378342-11378364 AGGCCTCCCCAGGACTGCACAGG - Intergenic
1155059631 18:22217319-22217341 AGCCCTGCCCAGCACTAAAAGGG - Intergenic
1157478158 18:48036452-48036474 AGGCCTCTCCAGCACCCCATGGG + Intronic
1160426137 18:78780443-78780465 GGGCCTCTCCTTCACTGACACGG - Intergenic
1161243570 19:3236328-3236350 AGGCCACACATGCACTGAAAAGG - Intronic
1161604618 19:5207769-5207791 AGACCCCTCCCGCACTGGAAGGG - Intronic
1162183335 19:8885807-8885829 TGCCCTCTCCAGGCCTGAAAAGG - Exonic
1164628844 19:29747727-29747749 TGGCCTCCCCAGCACTGACAGGG + Intergenic
1164825498 19:31282266-31282288 AGGCATCTCCAGGACAGAAGGGG - Intronic
1166392256 19:42415385-42415407 AGGCATGTCCAGTGCTGAAACGG + Intronic
926753171 2:16215846-16215868 ATGACTCTCCATCACTGGAAGGG - Intergenic
926865336 2:17350941-17350963 AGCCCTCCCCAGAACTGAATGGG - Intergenic
928786938 2:34899301-34899323 AGGCCTCTGCACCACTCAAATGG + Intergenic
931235476 2:60409210-60409232 AGACATCTCCCACACTGAAAGGG + Intergenic
931374972 2:61698778-61698800 AGTCCTCCTGAGCACTGAAAGGG + Intergenic
934866000 2:97811868-97811890 AGCACTCACCAGTACTGAAAGGG - Intronic
939728369 2:145751929-145751951 AGGCCACTTCAGCACTTAACGGG - Intergenic
942736084 2:179114860-179114882 ATGGCTCTCCAGCACTGGTAAGG + Intronic
946164016 2:217852959-217852981 AGGCCTGTCCAGCCCTGATGAGG + Intronic
1169098469 20:2924659-2924681 GAGCCTCTGCAGCACCGAAAAGG + Intronic
1169917385 20:10697089-10697111 AGGGCCCTGCAGAACTGAAAAGG - Intergenic
1173446355 20:43122387-43122409 AGGCCTTTCTAGGACTGAGAGGG - Intronic
1174057251 20:47806650-47806672 AGGCTTCTCCAGCAGAGAAGAGG - Intergenic
1174347708 20:49943157-49943179 AGCCCTATTCAGCATTGAAATGG - Intronic
1175122136 20:56724042-56724064 AGGCATTTCCAGCACCCAAATGG + Intergenic
1177844473 21:26272414-26272436 GGACCTCTCCATGACTGAAAAGG + Intergenic
1179076730 21:38129222-38129244 AGGCCTCTCCAGAACTGTGAAGG + Intronic
1179429807 21:41313082-41313104 AGGCCACTCTAGGCCTGAAATGG + Intronic
1180001250 21:44996560-44996582 AGGCATCTCCAGCCCTGAGCGGG + Intergenic
1182091566 22:27598867-27598889 AGGCTCCTCAAGCTCTGAAAAGG - Intergenic
1182666516 22:31964187-31964209 AGGCCACTTCTGCAGTGAAATGG + Intergenic
1184034643 22:41912708-41912730 AGGTCTCCCCAGCAGAGAAAAGG + Intronic
1184464389 22:44660371-44660393 AGGCCACTCCAGGACTGCGATGG - Intergenic
1184734737 22:46391430-46391452 ACCCCTCTCCAGCTCTGACATGG - Intronic
951960549 3:28314344-28314366 AGGACTCTCTAACACTCAAAAGG - Intronic
952837797 3:37619201-37619223 ATGCCTCTCCACTACTGATATGG + Intronic
954198830 3:49012344-49012366 AATCCTCTCCTGCACTGATAAGG - Exonic
956861405 3:73327490-73327512 AGTTCTCTCCAGGACTGAACTGG + Intergenic
958504915 3:94963701-94963723 AATCCTCTGCAGTACTGAAATGG + Intergenic
958895888 3:99828966-99828988 AGGCCTGGGCAGCATTGAAAGGG - Intronic
962708600 3:138067672-138067694 AGTCCTCTTCAGAACTGAACGGG + Exonic
963895609 3:150682458-150682480 AAGCCTCACCAGCCCTTAAATGG - Intronic
964680612 3:159334378-159334400 AGGATTTTCCAGCACTGATATGG - Intronic
967426600 3:189334508-189334530 AGTCCTCTCCATCTCTAAAATGG + Intergenic
969329707 4:6467077-6467099 AGGGCACCCCAGCACTGAAATGG + Intronic
977021427 4:91765294-91765316 AGGCCTCTCCAGGCCTAGAAGGG + Intergenic
977563346 4:98556073-98556095 ATGGCTCTTCAGCACTGAACTGG + Intronic
979555737 4:122044947-122044969 ATGACTCTCCAGCAATGAAAGGG + Intergenic
979559409 4:122085004-122085026 AGGCCTTTCAAACAATGAAATGG - Intergenic
983430839 4:167648748-167648770 AGTCCTCTCCAGCGCTGGTAAGG - Intergenic
983473509 4:168185897-168185919 AGGCCTCTGGAGAGCTGAAATGG + Intronic
988554480 5:32224211-32224233 ACTCATCCCCAGCACTGAAAGGG - Intergenic
991468014 5:66935512-66935534 AGGCTTCTCCGGGACAGAAAGGG - Intronic
991766362 5:69984866-69984888 AGGTGTCTCCAGCACTGTATAGG + Intergenic
991780956 5:70133287-70133309 AGGTGTCTCCAGCACTGTATAGG - Intergenic
991845595 5:70859949-70859971 AGGTGTCTCCAGCACTGTATAGG + Intergenic
991873402 5:71133601-71133623 AGGTGTCTCCAGCACTGTATAGG - Intergenic
992400314 5:76404718-76404740 AGGCCTCCCCCTCACTGCAAGGG - Intronic
994379956 5:99058900-99058922 AGTCTCCTCCAACACTGAAAAGG + Intergenic
1001044031 5:168357540-168357562 CAGCCTCTCAAGCACAGAAAGGG - Intronic
1001122496 5:168991919-168991941 GGGCCTCTCCGGCCCTGAAAGGG - Intronic
1002050617 5:176568617-176568639 TGGCCAGACCAGCACTGAAAGGG + Intronic
1002618733 5:180471279-180471301 CGGCTTCTCCATCAGTGAAACGG - Intergenic
1006316676 6:33295716-33295738 AGGCCTCCCAGGCACTGAGAGGG + Exonic
1007932997 6:45709026-45709048 AGGCCCTTGCAGCACTGAAGGGG + Intergenic
1013824880 6:114199729-114199751 AGGCCTATCTAGCTCTCAAAAGG - Intronic
1015005434 6:128274886-128274908 AGACCTCACCAGCACCAAAAAGG - Intronic
1017247212 6:152239572-152239594 AGGCTTCTGCTGTACTGAAACGG - Exonic
1018023224 6:159782607-159782629 AGGACTCCCCATCACTAAAATGG + Intronic
1018267420 6:162040193-162040215 TGGTCTCTCCAGCACAGAAGCGG + Intronic
1019290092 7:246067-246089 AGGCCTCTCCTGCACTGGCTGGG - Intronic
1019768528 7:2869100-2869122 AGGCCCCACCAGAACTGGAATGG - Intergenic
1020285494 7:6676556-6676578 AGGCCTCTCCACAAATGAAATGG + Intergenic
1021363896 7:19752442-19752464 AGGCCTCACCAGCCCTTAACAGG + Intronic
1022646306 7:32231647-32231669 ACTGCTCTCCAACACTGAAAAGG + Intronic
1023894310 7:44419193-44419215 AGGCCTCTTTAGCACTGTTAGGG - Intronic
1023944205 7:44790634-44790656 ATGCCTGTCAAGCACAGAAATGG - Intergenic
1029812778 7:103066017-103066039 GGGTCCCTCCAGCACTGACAAGG + Intronic
1032189012 7:129752202-129752224 AGGCTGCTCCAGCATTGATAAGG + Intronic
1032607468 7:133371165-133371187 ACACCTCTCTAGCACTGAAGAGG - Intronic
1034536064 7:151726607-151726629 AGGGTTCTGCAGCAATGAAATGG + Intronic
1035448151 7:158957011-158957033 TGTCCTCTCCAGCCCTGAACTGG + Intergenic
1035827264 8:2657999-2658021 AAGCCTATCCATGACTGAAATGG - Intergenic
1041497808 8:58506469-58506491 CTGCATCTCCAGCACTTAAAAGG - Intergenic
1044504963 8:93006660-93006682 CGGTCTCCCCAGCACTGACAGGG - Intronic
1045315122 8:101037226-101037248 AGGCATCCACAGCACTGAATTGG + Intergenic
1046450933 8:114388333-114388355 AGGTATGTCCAGCACTGGAATGG + Intergenic
1048828942 8:138457253-138457275 AGGCATCTCCAACACTGAGCAGG + Intronic
1048829858 8:138465471-138465493 AGGCAGCTCCATCAGTGAAAAGG - Intronic
1049378004 8:142298197-142298219 AGGCCTCTCCATCTCTGAGCTGG + Intronic
1050765930 9:9133872-9133894 AGACCACAACAGCACTGAAAGGG + Intronic
1051577817 9:18637288-18637310 AGCCCTCTCCAGTTCTCAAATGG - Intronic
1053466372 9:38311579-38311601 AGTCCTGCCCAGCACTGCAAAGG - Intergenic
1053791016 9:41686288-41686310 AGGCCTTGACAGAACTGAAAAGG + Intergenic
1054179362 9:61897982-61898004 AGGCCTTGACAGAACTGAAAAGG + Intergenic
1054658176 9:67682839-67682861 AGGCCTTGACAGAACTGAAAAGG - Intergenic
1055566053 9:77569404-77569426 TGGCCCCTCCAGCACTGGAGAGG - Intronic
1056828074 9:89890649-89890671 AGGGCTCCCCAGCACTGGAGCGG - Intergenic
1057958275 9:99430010-99430032 AGGCCAATACAACACTGAAATGG + Intergenic
1062195429 9:135270955-135270977 AGGCCTCCCTTGCTCTGAAACGG - Intergenic
1185466096 X:354984-355006 ACGGCTCTCCAGCACTGCACTGG + Intronic
1192590436 X:72355262-72355284 AGGCCCCTCCAGCCCCGAAGAGG + Intronic
1195093715 X:101487031-101487053 GGGCTTCCCCAGCACTGAAATGG - Intronic
1195273522 X:103255485-103255507 AATCCTATCCAGCATTGAAATGG + Intergenic
1195310764 X:103629649-103629671 AGGCCTCGCCCGCAGTGACAGGG - Intronic
1195672439 X:107481280-107481302 AGGCCCTGCCAGCACTGAGATGG - Intergenic
1196041569 X:111210482-111210504 AGGCCTGTTCAGCTCAGAAAAGG + Intronic
1198112149 X:133511053-133511075 TGGCCTCTCTAGCAGGGAAATGG + Intergenic
1198316298 X:135469881-135469903 AGGCTGCTGCAGCCCTGAAAAGG - Intergenic
1199969836 X:152851672-152851694 AAGCCTCTCCAGCTTTGAAGAGG + Intronic