ID: 1153472982

View in Genome Browser
Species Human (GRCh38)
Location 18:5467910-5467932
Sequence CCAAATCCACAGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153472982_1153472992 24 Left 1153472982 18:5467910-5467932 CCCAGCTGCAGCTGTGGATTTGG 0: 1
1: 0
2: 6
3: 39
4: 301
Right 1153472992 18:5467957-5467979 AGGAACCCCCCTGCCCCTACAGG 0: 1
1: 1
2: 7
3: 39
4: 197
1153472982_1153472988 -2 Left 1153472982 18:5467910-5467932 CCCAGCTGCAGCTGTGGATTTGG 0: 1
1: 0
2: 6
3: 39
4: 301
Right 1153472988 18:5467931-5467953 GGGCATCCCTGCACTCTCAGGGG 0: 5
1: 33
2: 75
3: 168
4: 463
1153472982_1153472987 -3 Left 1153472982 18:5467910-5467932 CCCAGCTGCAGCTGTGGATTTGG 0: 1
1: 0
2: 6
3: 39
4: 301
Right 1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG 0: 7
1: 19
2: 66
3: 113
4: 387
1153472982_1153472990 4 Left 1153472982 18:5467910-5467932 CCCAGCTGCAGCTGTGGATTTGG 0: 1
1: 0
2: 6
3: 39
4: 301
Right 1153472990 18:5467937-5467959 CCCTGCACTCTCAGGGGTACAGG 0: 1
1: 2
2: 10
3: 71
4: 287
1153472982_1153472986 -4 Left 1153472982 18:5467910-5467932 CCCAGCTGCAGCTGTGGATTTGG 0: 1
1: 0
2: 6
3: 39
4: 301
Right 1153472986 18:5467929-5467951 TTGGGCATCCCTGCACTCTCAGG 0: 1
1: 11
2: 36
3: 133
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153472982 Original CRISPR CCAAATCCACAGCTGCAGCT GGG (reversed) Intronic
901219211 1:7573537-7573559 CCAAAACCACAGCGCCAGCAGGG + Intronic
901300439 1:8196449-8196471 CTAAATCCACACCTCCAGCTTGG - Intergenic
901691078 1:10973803-10973825 TCCGATCCACAGCTGCAGTTTGG - Intronic
903070347 1:20724090-20724112 CCGAGCCGACAGCTGCAGCTGGG + Exonic
903082241 1:20820142-20820164 TCGAATCCACAGCTGCAGTTTGG - Intronic
904042702 1:27593554-27593576 CCACAGCCACGGCTCCAGCTGGG + Intronic
904672420 1:32175800-32175822 AAAAATCCACATCTTCAGCTGGG + Exonic
904683920 1:32247516-32247538 CCGAGTCTGCAGCTGCAGCTTGG - Exonic
907985236 1:59524013-59524035 CCAGGTCCAGAGCCGCAGCTGGG - Intronic
908259447 1:62327944-62327966 TCAGATCCACAGCCGCAGTTTGG + Intergenic
908489524 1:64629301-64629323 CCAAATCCACAGGTGCATGCAGG - Intronic
908909632 1:69058312-69058334 AGAAATCCACAGCAGCAGCAAGG - Intergenic
911275421 1:95853232-95853254 CCTAAGCCACAGCTGCAACCTGG + Intergenic
913500910 1:119471817-119471839 CCAACTCCAAAGCAGCATCTAGG + Intergenic
914392876 1:147237478-147237500 CCAGGTCTGCAGCTGCAGCTGGG + Intronic
914904107 1:151729801-151729823 ACAAAACCACAGCTGAAGCATGG - Intronic
916303565 1:163303670-163303692 CCAAACCCCCAGCTGCAGACAGG + Intronic
916423085 1:164654458-164654480 TTAAATCCACTGCTTCAGCTGGG + Intronic
917436098 1:175023184-175023206 CCAAATTGACATCTGCAGCTCGG + Intronic
918118559 1:181517559-181517581 CCACATCCTTAGCTGCAGTTTGG + Intronic
922153354 1:223023045-223023067 CCAGAGCCACAGTGGCAGCTGGG + Intergenic
922421427 1:225463299-225463321 CCAGATCCACGCCTCCAGCTGGG - Intergenic
923328050 1:232898229-232898251 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
923384750 1:233454990-233455012 CCAGACCCATTGCTGCAGCTGGG + Intergenic
1063272590 10:4527731-4527753 CCTATTCCACAGCTGCATCGGGG + Intergenic
1064340866 10:14484109-14484131 CCACGTCCCCAGCTGCAGGTGGG + Intergenic
1064412220 10:15115967-15115989 ACAAATCCACAATTACAGCTGGG + Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1065511197 10:26480048-26480070 CCAAATCCTGAGCTGGAGCTGGG + Intronic
1065696612 10:28386397-28386419 CCAAAGGCAGAGCAGCAGCTTGG - Intergenic
1065869903 10:29947440-29947462 TCAAAGCCACAGCTTCTGCTGGG + Intergenic
1067350476 10:45471346-45471368 CAAGATCCTCAGCTGCAGCATGG - Intronic
1068722517 10:60261867-60261889 TGAAATCCACAGCAGCCGCTCGG + Exonic
1069212411 10:65779020-65779042 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1071753718 10:88511507-88511529 CCAAACACACATCTTCAGCTTGG - Intronic
1074028627 10:109663145-109663167 CCAGGTCCACAGCTGTGGCTTGG - Intergenic
1074415273 10:113262010-113262032 CCAAATGAACAGCTGCATCCCGG - Intergenic
1075949242 10:126462888-126462910 CCAAAGCGACAGCTGCAAGTGGG - Intronic
1078303217 11:10156035-10156057 CCGGGTCCAGAGCTGCAGCTGGG - Intronic
1079184244 11:18221715-18221737 CCAGGTCCACAGCCACAGCTTGG + Intronic
1081876909 11:46414671-46414693 CCAGAGGCACAGCAGCAGCTTGG + Intronic
1082710404 11:56547567-56547589 CCAACCCCACAGCAGCATCTAGG - Intergenic
1084208135 11:67607722-67607744 CCAAACCCACAGCTGCATCACGG - Intronic
1084398717 11:68931492-68931514 GCAGATCCACAGCTGCAGTTTGG + Intronic
1084981985 11:72834301-72834323 CAAAACCAAAAGCTGCAGCTGGG + Intronic
1086085193 11:82946082-82946104 CCAGGTCCACAGCTGCAGTTTGG + Intronic
1087281471 11:96215696-96215718 CCTCCTCCACACCTGCAGCTGGG + Intronic
1087385115 11:97461302-97461324 CCAGATCCACCGCCACAGCTGGG - Intergenic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089032894 11:115351789-115351811 CCAATTCCAGAGCTGCAGAGGGG - Intronic
1089172871 11:116527578-116527600 TCCGATCCACAGCTGCAGTTTGG - Intergenic
1090258617 11:125303140-125303162 CCAAAACCTGACCTGCAGCTGGG + Intronic
1092507986 12:9124398-9124420 TCAGATCCACAGCCGCAGTTTGG - Intergenic
1092557731 12:9575266-9575288 CAAAGTCCACAGCAGTAGCTTGG - Intergenic
1093059717 12:14589659-14589681 TCAGATCCACAGCAGCAGTTTGG + Intergenic
1093390345 12:18611501-18611523 CCAAATCTACAATTCCAGCTTGG + Intronic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1094075222 12:26465019-26465041 CCAAATGCACATCTTCAGCGTGG - Intronic
1095546098 12:43372118-43372140 CCAAATGCACATTTCCAGCTTGG - Intronic
1095727395 12:45469086-45469108 TCAGATCCACAGCTGCAGTTTGG - Intergenic
1098492217 12:71094769-71094791 CCAAATGCAGAGCTGCCCCTTGG + Intronic
1098698559 12:73592085-73592107 CCAATTCCACAGCTGCTACCAGG + Intergenic
1100206414 12:92354678-92354700 CCAACTCCACAGCAGCGTCTCGG - Intergenic
1100503748 12:95199166-95199188 CCAAAACCAGAGCTCCAGCCTGG - Intronic
1100504794 12:95208864-95208886 CCAGATGGCCAGCTGCAGCTTGG - Exonic
1100847751 12:98678457-98678479 CCAGGTCCACAGCTGTGGCTTGG - Intronic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1101963333 12:109265801-109265823 CCAAAGTCACAGCTGGAGCAGGG + Intronic
1102060280 12:109926334-109926356 TCAAATCCACAACTGCAGTTTGG - Intronic
1102732568 12:115125882-115125904 CCATAGCCACAGCTCCTGCTGGG + Intergenic
1103560180 12:121789531-121789553 CCAACGCCGCAGCTGGAGCTGGG - Intronic
1105479854 13:20764605-20764627 ACAAATCCACAATTACAGCTGGG - Intronic
1105545499 13:21347927-21347949 CCCAAGCCACAGCTGCAGCCCGG + Intergenic
1106620156 13:31364880-31364902 ACCAATCCACAGCCGCAGTTTGG - Intergenic
1106892053 13:34256314-34256336 GCAAGTCCACAGCTTCTGCTAGG - Intergenic
1107338760 13:39383804-39383826 CCACATTCACACCTGCAGCCAGG + Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1111000014 13:82165903-82165925 TCAGATCCAAAGCTGCAGTTTGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1111595277 13:90403599-90403621 CCAGGTCCACAGCCACAGCTAGG - Intergenic
1115059022 14:29168383-29168405 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1115617851 14:35113335-35113357 ACAAATCCATAGCTGCAGACAGG + Intronic
1119618043 14:76111739-76111761 TCAGATCCACAGCTGCAGTTTGG - Intergenic
1119749509 14:77067376-77067398 CCAAGTTCACAGCTGTGGCTGGG - Intergenic
1121553197 14:94817981-94818003 CCAAGTCCACAGCTGCTCCCTGG - Intergenic
1121553483 14:94819574-94819596 TCAGATCCACAGCTGCAGTTTGG + Intergenic
1122011597 14:98753724-98753746 CCAAATCCTCATTTACAGCTAGG + Intergenic
1122607934 14:102960236-102960258 TCAAAACCACAGGGGCAGCTGGG + Intronic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1127572108 15:60253671-60253693 CCAAATACACTGCTGCAGGAGGG + Intergenic
1127752552 15:62060279-62060301 CCAGATGCCCAGCTTCAGCTGGG + Exonic
1128650957 15:69413394-69413416 CCAAATACACATCTACACCTGGG - Intergenic
1129742209 15:77994743-77994765 CCCAGCCCACACCTGCAGCTTGG + Intronic
1129843273 15:78756737-78756759 CCCAGCCCACACCTGCAGCTTGG - Intergenic
1129852763 15:78803853-78803875 ACAAAACCACAGGTGCTGCTGGG + Intronic
1130713896 15:86312664-86312686 CAAAATCCACAGCTGCCACCTGG - Intronic
1131222534 15:90597084-90597106 ACCAAGGCACAGCTGCAGCTGGG + Intronic
1131576160 15:93593468-93593490 CAAAATTCACTGCTGAAGCTGGG - Intergenic
1131605953 15:93902456-93902478 CCAAATCCAAATCTGCAGGTGGG - Intergenic
1131978285 15:97968573-97968595 CCAAATCCACTGCTGGAAATGGG - Intronic
1132295667 15:100732511-100732533 CCAAATCCCCAGGCCCAGCTTGG + Intergenic
1132534780 16:472771-472793 CCACATCCACAGCTGCTGGGTGG - Intronic
1133769663 16:8860381-8860403 TCAAAAGCACAGCAGCAGCTAGG - Intronic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1136155327 16:28378251-28378273 ACAAATTCACAGCTGGGGCTGGG - Intergenic
1136207756 16:28737037-28737059 ACAAATTCACAGCTGGGGCTGGG + Intergenic
1136418084 16:30115559-30115581 CCACACCCAGAGCTGAAGCTTGG + Intronic
1136655716 16:31707994-31708016 CCACATGAACATCTGCAGCTTGG - Intergenic
1138203371 16:55106442-55106464 CCAAATACACAGCTCTAGCCCGG - Intergenic
1141713832 16:85715841-85715863 CCAGAACCCCAGCTGCAGGTGGG + Intronic
1141794033 16:86257472-86257494 TCAAATTCACAGCTGCACTTGGG + Intergenic
1141876912 16:86831506-86831528 CCAGCTCCACAGCTGCTGATGGG + Intergenic
1142962336 17:3558635-3558657 CCCACTTCACAGCTGCAGCCTGG - Intergenic
1143867480 17:9934576-9934598 CCAAAGCCTCAGCTGCAGTGAGG + Intronic
1145123291 17:20279779-20279801 CCAAAACCACAGCTCTGGCTGGG - Intronic
1145983337 17:29027435-29027457 CCCAGTTCACAGCTGCAACTTGG - Intronic
1146122117 17:30204850-30204872 CCACATCCAAAGCTGCACGTGGG + Intronic
1146459320 17:33033278-33033300 TCAGATACACAGCTGCAGTTTGG - Intronic
1146605663 17:34255570-34255592 CCAACCACACAGCTGCTGCTCGG + Intronic
1147362442 17:39939817-39939839 CCACATCTGCAGCTCCAGCTGGG + Intergenic
1147851886 17:43450099-43450121 AAAAACCCACAGCTGCTGCTAGG - Intergenic
1149160556 17:53687412-53687434 TCAGATCCACAGCTGCAGTTTGG + Intergenic
1149998497 17:61417288-61417310 CCAGAACCAAAGGTGCAGCTGGG - Intergenic
1150594659 17:66593533-66593555 CCACATGCACAGCTGAAACTTGG + Intronic
1150855187 17:68745550-68745572 CCAACCCCACAGCAGCATCTAGG - Intergenic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1150999068 17:70352406-70352428 CCAACCCCACAGCAGCATCTAGG - Intergenic
1151413998 17:73949681-73949703 CCAAACCCACAGAGGCAGCGTGG + Intergenic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1154346703 18:13548683-13548705 CCATGTCCACAGCTGTGGCTGGG + Intronic
1155215651 18:23641277-23641299 CCAGAACCGGAGCTGCAGCTGGG - Intronic
1158639928 18:59195143-59195165 CCAATCCCACAGCTCCAGCTAGG + Intergenic
1159623747 18:70669084-70669106 TCCAAGCCACAGCTGCAACTTGG - Intergenic
1159774375 18:72586038-72586060 CCAGGTCTGCAGCTGCAGCTGGG + Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161055061 19:2186781-2186803 TGAAATCCACAGCAGCAGGTCGG - Intronic
1161168893 19:2803306-2803328 TCAAATCCACAAGTGCAGCGGGG + Intronic
1161218388 19:3106133-3106155 CCAAAGCCACAGCCCCAACTCGG - Intronic
1161780069 19:6286063-6286085 CCTAATCTGCAGCTGCAGTTTGG - Intergenic
1162328704 19:10013678-10013700 CCAAGCCCACAAGTGCAGCTGGG - Intronic
1163095495 19:15054280-15054302 CCAAAGCCCCAGCTGAAGCCAGG + Intronic
1165027073 19:32969809-32969831 TCGGATCCACAGCTGCAGTTTGG + Intronic
1166134288 19:40766203-40766225 TCTAATCCAGAGCTGCAGCTGGG - Intergenic
1166312669 19:41971589-41971611 ACAACTCCACAGCTGGACCTTGG + Intronic
1167234955 19:48308790-48308812 TCAGATCCACAGCAGCAGTTTGG - Intronic
1168721873 19:58558716-58558738 CCGAGTCCGCAGCTGCAGCGGGG - Exonic
926070509 2:9884813-9884835 CCACGTCCACAGCTGTGGCTTGG - Intronic
927398686 2:22685767-22685789 TCAAATGCACAGCTGCAGTCAGG + Intergenic
928931611 2:36630850-36630872 CCTAATACACAGGTACAGCTGGG + Intronic
929641371 2:43583343-43583365 CCAACTCCACTGCTACATCTTGG + Intronic
929847253 2:45542386-45542408 CCAGGTCCAGAGCTGTAGCTGGG + Intronic
929961323 2:46498344-46498366 CCAAATCCTCAACTTCTGCTTGG + Intronic
930957140 2:57216964-57216986 CCCATTCCACAGCTGTGGCTTGG - Intergenic
930957161 2:57217053-57217075 CCAGGTCCACAGCTGTAGCTTGG - Intergenic
931746141 2:65293546-65293568 TGAACTCCACAGCCGCAGCTGGG - Intergenic
932485190 2:72080472-72080494 CCCAAGCCACAGCTGCAACCTGG + Intergenic
932668983 2:73720268-73720290 CCAAACCCGCATCTGCACCTGGG - Intergenic
933339750 2:81007848-81007870 CCAAACACACACCTGTAGCTGGG - Intergenic
935667457 2:105525216-105525238 CCAGGTCCAGAGCTGCAGCTGGG - Intergenic
937041954 2:118829421-118829443 CCAGGACCACAGCTGCAGCAGGG + Intergenic
938195029 2:129319399-129319421 TCATATCCACAGCTGCAGGTTGG + Intergenic
939298266 2:140297942-140297964 CCCAGTGCACAGCTGCAGGTGGG + Exonic
939464546 2:142540803-142540825 CAAATTCAATAGCTGCAGCTCGG + Intergenic
939659322 2:144868669-144868691 CCAAATCCAAATCTCCAGATGGG - Intergenic
940957049 2:159739156-159739178 CCAAGTCTACAGCCACAGCTGGG + Intronic
941130950 2:161650537-161650559 CCAGATCCAGAGCCACAGCTAGG - Intronic
941440444 2:165528926-165528948 CCAAGTCCACAGCTATGGCTTGG - Intronic
943427113 2:187750469-187750491 CCAGATCCACAGCCTCAGCTGGG + Intergenic
943795552 2:191988490-191988512 CCAAATTCACTTCTGCAGATTGG - Intronic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
945721193 2:213421113-213421135 CCAGGTCCAGAGCTGCAGCTGGG - Intronic
948650488 2:239440446-239440468 CCAGAACAACAGCTGCACCTGGG - Intergenic
948678261 2:239611809-239611831 CCAAAGCTCCAGCAGCAGCTGGG - Intergenic
948732499 2:239975902-239975924 CCAAAGCCACAGCACCAGCCAGG + Intronic
1168920773 20:1533816-1533838 CCTCATCCCCAGCTGGAGCTTGG - Intergenic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1170893497 20:20395183-20395205 GCAAAGCCACCCCTGCAGCTGGG + Intronic
1172676573 20:36676968-36676990 TGAGATCCACAGCTGCAGTTTGG - Intronic
1173493892 20:43505172-43505194 CCAACCCCACAGCAGCATCTAGG - Intergenic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1176013180 20:62911440-62911462 CCACCCCCACAGCAGCAGCTGGG - Exonic
1176986785 21:15446341-15446363 CCAAAACTACAGCTCCAACTGGG - Intergenic
1177357930 21:20032170-20032192 CCAGGTCAACAGCTGTAGCTGGG + Intergenic
1178601860 21:34001260-34001282 CCAAATCCCCAGTTCTAGCTAGG - Intergenic
1179192188 21:39133125-39133147 CCTAAACCTCAGCTGCAGCTCGG - Intergenic
1179542633 21:42093581-42093603 CCACATCCACAGCTGGCTCTGGG - Intronic
1180013521 21:45067663-45067685 CCATAGCCACAGCTGCCTCTGGG - Intergenic
1180678606 22:17607008-17607030 CCAAAACCACAGCTCCAGCAGGG + Intronic
1183224019 22:36536912-36536934 CCCACTCCACAGCTAGAGCTGGG - Intergenic
1183922071 22:41177474-41177496 CCATTTCCACTGCTGCAGGTGGG - Exonic
1184561026 22:45263004-45263026 CCCAAACCACAGCTGCAGACCGG - Intergenic
1184944885 22:47795992-47796014 TCCACTCCACAGCTGCAGCCTGG + Intergenic
951798318 3:26566746-26566768 TCGGATCCACACCTGCAGCTTGG + Intergenic
952455221 3:33466267-33466289 CCAGTTCCACAGCTTCACCTGGG - Intergenic
953769643 3:45770226-45770248 GCAAATCAAAAACTGCAGCTTGG - Exonic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
956305577 3:67820934-67820956 CCAAGACCACAGCTGCTGTTTGG - Intergenic
957678652 3:83403930-83403952 TCAGATCCACAGCAGCAGTTTGG - Intergenic
958019752 3:87980957-87980979 CCAGGTCCACAGCTGTAGCTGGG + Intergenic
958053096 3:88374391-88374413 CCAAATCCATATCTTCAGCCTGG - Intergenic
960496447 3:118381602-118381624 CCAAATCCATCACTGGAGCTGGG + Intergenic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
962806419 3:138930555-138930577 CCAAATCATCAGCAGCACCTAGG - Intergenic
964758777 3:160114191-160114213 CCCACTCCACAGCAGCAGCATGG + Intergenic
964791950 3:160460731-160460753 TCGGATCCACAGCTGCAGTTTGG + Intronic
966676453 3:182595417-182595439 CCAAATACACGTGTGCAGCTGGG - Intergenic
966933390 3:184690344-184690366 TAAAATCCACAGCTGCTGCGGGG - Intergenic
972128493 4:35800945-35800967 CTAAGTCCACAGCTGCAGTTTGG - Intergenic
972390211 4:38606745-38606767 CCAACCCCACAGCAGCATCTAGG + Intergenic
973851689 4:54967184-54967206 CCAAAACCACAGCTTCATATTGG + Intergenic
975599764 4:76086989-76087011 CCAAAAACCCGGCTGCAGCTGGG + Intronic
976734615 4:88296943-88296965 CCAGATCCATAGCTGTGGCTTGG + Intergenic
977074337 4:92433582-92433604 CCAACTCCCCAGCAGCAGGTGGG - Intronic
977173624 4:93792907-93792929 CCACATCCACTGCTCCAGGTAGG + Intergenic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978248672 4:106604745-106604767 CCAGGTCCACAGTTGCAGCCAGG + Intergenic
978847932 4:113296790-113296812 CCCAATCCACTAATGCAGCTTGG + Intronic
978964663 4:114725935-114725957 TCAGACCCACAGCTGCAGTTTGG + Intergenic
980450045 4:132958822-132958844 CTAGGTCCACAGCTGCAACTTGG - Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982089282 4:151866580-151866602 TCAAATGCAGAGCTGCAGCCTGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
985145677 4:186892100-186892122 CCAGCTCTACAGCTGGAGCTTGG + Intergenic
985680312 5:1252700-1252722 CCGGATCCACGGCTGCAGGTGGG + Intergenic
989317459 5:40099047-40099069 CCAGAGACACAGCAGCAGCTTGG - Intergenic
989730560 5:44642293-44642315 CCAGATCTAGAGCTGCAGCTGGG + Intergenic
989730709 5:44644681-44644703 ACAAATCAGCAGCTGCTGCTAGG - Intergenic
989745367 5:44822421-44822443 CCAAAACCACAACTGCAGTAAGG - Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
993703449 5:91144116-91144138 CCAGGTCTGCAGCTGCAGCTTGG + Intronic
994593809 5:101806552-101806574 CCAAGTCCACAGCCGTGGCTGGG - Intergenic
994881199 5:105498598-105498620 CCAGCTACACAGCTGCTGCTAGG + Intergenic
994881368 5:105501485-105501507 CCAGCTGCACAGCTGCTGCTAGG - Intergenic
996183733 5:120451474-120451496 CCAGATCCGCAGCCACAGCTTGG + Intergenic
996774301 5:127117599-127117621 CCAAAACAACAGCAGCAACTGGG - Intergenic
997371952 5:133367608-133367630 CCATTTGAACAGCTGCAGCTTGG + Intronic
998480629 5:142459694-142459716 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1000742546 5:164987464-164987486 CCAAGCCCACAGCAGCATCTAGG - Intergenic
1000854344 5:166379808-166379830 CCAGGTCCACAGCCACAGCTGGG + Intergenic
1003473856 6:6463028-6463050 CCATAGGCACAGCAGCAGCTTGG - Intergenic
1003923444 6:10855459-10855481 TCTGATCCACAGCTGCAGTTTGG - Intronic
1004304360 6:14487142-14487164 CCAGGTCTACAGCTGCAACTTGG - Intergenic
1005251606 6:23952443-23952465 GTAAATCCTCAGCTGCTGCTTGG - Intergenic
1006433069 6:34010038-34010060 CCAAATTCACAGCTCCACCTAGG + Intergenic
1006446028 6:34080179-34080201 GCAGATCCCCAGCTGCAGCGAGG - Intronic
1007396814 6:41582730-41582752 CCACATCCACCCCTGCAGCCTGG + Intronic
1009684179 6:66935739-66935761 CCAGGTCCGGAGCTGCAGCTGGG - Intergenic
1010627329 6:78154312-78154334 CCATAGGCACAGCAGCAGCTTGG - Intergenic
1010652154 6:78467851-78467873 CCAGATCTCCAGCTGCTGCTGGG - Intergenic
1010664383 6:78611191-78611213 CCAGGTCCTCAGCTGCAGATGGG - Intergenic
1012122283 6:95384023-95384045 CCAGGTCCACAGCCACAGCTTGG - Intergenic
1012709465 6:102581551-102581573 CCTGGTCCAGAGCTGCAGCTTGG - Intergenic
1013236182 6:108199228-108199250 TCGAATTCACAGCTGCAGTTTGG + Intergenic
1014202369 6:118620822-118620844 CCACCTCCTCAGCTGCAACTGGG + Intronic
1014226375 6:118852569-118852591 GCAAGTTCACAGCTGAAGCTTGG - Intronic
1015578944 6:134702526-134702548 CCCATTCCCCAGCAGCAGCTGGG - Intergenic
1017309955 6:152964335-152964357 ACAAATCCACAATTACAGCTAGG + Intergenic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1018831055 6:167443874-167443896 CCAGACCCACAGCAGCATCTAGG + Intergenic
1019016054 6:168880248-168880270 CCATATCCAGAGCTGCAAATCGG + Intergenic
1019727327 7:2610373-2610395 CCTCATCTCCAGCTGCAGCTCGG + Exonic
1020568165 7:9822990-9823012 TCAGATCCACAGCTGCAGTTAGG + Intergenic
1021343224 7:19489547-19489569 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1021561526 7:21972558-21972580 TCAGATCCACAGCTGCAGTTTGG + Intergenic
1023789002 7:43737317-43737339 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1026164876 7:67900852-67900874 CCAAGTCCACTGCTGCATCTTGG - Intergenic
1027333858 7:77127322-77127344 TCAGATCTACAGCTGCAGTTTGG + Intronic
1028136659 7:87230180-87230202 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1028378994 7:90176929-90176951 CCAGGTCCACAGCTGTGGCTTGG + Intronic
1030673120 7:112358870-112358892 CCAAATCCCCAGCTCCAGACAGG + Intergenic
1031978590 7:128109378-128109400 ACATATACACAGCTGCTGCTGGG - Intergenic
1032658423 7:133955983-133956005 CCAGGTCCACAGCTCCAGTTTGG + Intronic
1033635672 7:143209490-143209512 CCAACCCCACAGCAGCATCTAGG + Intergenic
1034730116 7:153380069-153380091 CCAAGTCCACAGCTGCATCCGGG + Intergenic
1034848484 7:154470953-154470975 CGAAAAACACAGCTGCAGCCGGG + Intronic
1034980433 7:155472451-155472473 CCAAATGTACAGTTGGAGCTTGG - Intergenic
1035108835 7:156463722-156463744 TCATATCCCAAGCTGCAGCTAGG - Intergenic
1035450850 7:158976086-158976108 TCATATCCACAGCTGCAGTTTGG - Intergenic
1035740807 8:1927079-1927101 TCACATCCACAGCTCCTGCTTGG + Intronic
1037672855 8:21029996-21030018 CGATATCCACAGCAGCAGCATGG - Intergenic
1038584409 8:28776311-28776333 CCAAACCCACAGCGCCAGCCCGG - Intronic
1039613573 8:38937676-38937698 CAAAACCCACAGCTGCCACTGGG + Intronic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1042624992 8:70748285-70748307 CCAGGTCTAGAGCTGCAGCTGGG - Intronic
1044867890 8:96590306-96590328 ACAAGTCCAGAGCTGCAGCCTGG - Intronic
1046750754 8:117923849-117923871 ACAATTCCAAAGCTGCATCTTGG + Intronic
1047368289 8:124232906-124232928 CCACAACAAAAGCTGCAGCTAGG - Intergenic
1047538790 8:125743854-125743876 CCAAATCCACAGCTGTTTCCAGG - Intergenic
1047586562 8:126279957-126279979 CCAAACCCACAGCAGCATCTAGG - Intergenic
1047625611 8:126653084-126653106 TCCATTCCACAGCTGCATCTAGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048091357 8:131243936-131243958 CAGAATCCACAGCAGGAGCTTGG + Intergenic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1049156067 8:141067587-141067609 CCAAATCCACTTCTGGATCTAGG - Intergenic
1049698245 8:143994091-143994113 CCAAGTCCAAAGCTGCCTCTGGG - Intronic
1049817255 8:144611452-144611474 ACAAATCCACAGTTGTAGTTGGG - Intergenic
1049910377 9:260121-260143 CCAACTTCACATCTGCAACTGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053076481 9:35138793-35138815 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1053122009 9:35554700-35554722 CCAAACCCACAGCTTTAGCCTGG - Intronic
1053361488 9:37489924-37489946 CCACATCCACAGCCCCAGCTTGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053664407 9:40307513-40307535 GCAAAGCCACAGGTGCAGATTGG + Intronic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054520207 9:66068772-66068794 GCAAAGCCACAGGTGCAGATTGG - Intergenic
1056192129 9:84194816-84194838 TCAGATCCACAACTGCAGTTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057548378 9:96034733-96034755 CCCTGTCCCCAGCTGCAGCTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057848408 9:98544140-98544162 TCAAATCCAGAGCTGCTGCTGGG - Intronic
1059565422 9:115379611-115379633 CCAGATCCACATTTGCAGTTTGG - Intronic
1060824223 9:126678448-126678470 TCAAATGCCCAGCTTCAGCTGGG - Intronic
1061245273 9:129398392-129398414 AGAAATCCCCAGCTGCTGCTGGG - Intergenic
1061798866 9:133103590-133103612 CCAAACACAGAGCTGCAGCAGGG - Intronic
1062004808 9:134233822-134233844 CCAGCTCCCCAGCTGCAGCCAGG + Intergenic
1062183459 9:135203388-135203410 CCAAATCCAGCCCAGCAGCTTGG - Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1062461293 9:136663581-136663603 CCAAAGCCACATCTGTAGCCAGG + Intronic
1185935887 X:4257024-4257046 TCAGGTCCACAGCTGCAACTAGG - Intergenic
1187470206 X:19562919-19562941 CCAAATGCACTGCTGCAGTGAGG + Intronic
1188105132 X:26139926-26139948 CCCAAGCCAGAGCTGCAGCCAGG + Exonic
1188844846 X:35059891-35059913 CCCAAGCCACAGCTGCAGCTAGG + Intergenic
1189360061 X:40343483-40343505 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1189677558 X:43477376-43477398 CTAAATCCACATCACCAGCTTGG + Intergenic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1191016249 X:55813375-55813397 CCAGATCTCGAGCTGCAGCTGGG - Intergenic
1191191276 X:57670314-57670336 GCAAAGCCCCAGCTGCAGATCGG + Intergenic
1194309979 X:92294300-92294322 ACAAATCCAAAACTTCAGCTGGG - Intronic
1194380173 X:93181345-93181367 TCAAATCCACAGCTGCAGTTTGG - Intergenic
1195125358 X:101803658-101803680 CCCAATCTAGAACTGCAGCTTGG + Intergenic
1195179389 X:102342024-102342046 CCCAATCCAGAACTGCAGCTTGG - Intergenic
1197451786 X:126628659-126628681 CCAAGTCCAAAGATGCATCTGGG + Intergenic
1197495260 X:127172049-127172071 CCAGATCCACAGCTTCACTTTGG - Intergenic
1197501249 X:127244508-127244530 CCAGGTCCTCAGCCGCAGCTTGG + Intergenic
1198189377 X:134287652-134287674 CCAGGTCTGCAGCTGCAGCTGGG - Intergenic
1199393169 X:147305707-147305729 CCAAGTGCACAGCTGTTGCTGGG - Intergenic
1199697273 X:150351687-150351709 CCAAAGCCCCAGCTGCAGATGGG - Intergenic
1200618270 Y:5408598-5408620 ACAAATCCAAAACTTCAGCTGGG - Intronic
1201067526 Y:10112431-10112453 TCAGATCTCCAGCTGCAGCTGGG + Intergenic
1201749809 Y:17420454-17420476 TCACCTCCTCAGCTGCAGCTGGG - Intergenic
1202243685 Y:22794828-22794850 CCAAATTCCCAGCAGCAGTTGGG + Intergenic