ID: 1153473570

View in Genome Browser
Species Human (GRCh38)
Location 18:5472378-5472400
Sequence CAGGAAATTACTGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153473563_1153473570 17 Left 1153473563 18:5472338-5472360 CCTTCCATCCTCCAGAGTCCTAG 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 204
1153473565_1153473570 13 Left 1153473565 18:5472342-5472364 CCATCCTCCAGAGTCCTAGAGGC 0: 1
1: 0
2: 10
3: 182
4: 408
Right 1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 204
1153473568_1153473570 -1 Left 1153473568 18:5472356-5472378 CCTAGAGGCATCATTCTTCAAGC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 204
1153473566_1153473570 9 Left 1153473566 18:5472346-5472368 CCTCCAGAGTCCTAGAGGCATCA 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 204
1153473567_1153473570 6 Left 1153473567 18:5472349-5472371 CCAGAGTCCTAGAGGCATCATTC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153473570 Original CRISPR CAGGAAATTACTGCTGCTGC TGG Intronic
901012581 1:6209938-6209960 GAGGAAAGCGCTGCTGCTGCAGG + Exonic
902234084 1:15046736-15046758 CAGGAAAAAGCTGCGGCTGCAGG + Intronic
903118613 1:21198567-21198589 CAGGAAGGGGCTGCTGCTGCAGG + Intergenic
906227046 1:44130727-44130749 CAGGACAGTCCTCCTGCTGCTGG + Exonic
908635853 1:66164204-66164226 CAAGAAATTACTACTACTGGTGG + Intronic
911775846 1:101811678-101811700 CAGGAAACAACAGCTGCTGGAGG + Intronic
912182986 1:107240545-107240567 CATCAAATGACTGCTGCAGCAGG - Intronic
917021327 1:170591263-170591285 GAGGAAACTAGGGCTGCTGCTGG + Intergenic
917284141 1:173407005-173407027 CAGGATATTACAGCAGCAGCAGG + Intergenic
918356775 1:183712137-183712159 CAGGAAATTACTACTGCCCAAGG - Intronic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
919469924 1:197965616-197965638 CAGGAAATTAATTCTGCCTCAGG + Intergenic
920569469 1:207005703-207005725 TAGGAAGTTACTGCAGCAGCAGG + Intergenic
921835670 1:219775528-219775550 CAGGAAACAACAGCTGCTGGAGG - Intronic
922868964 1:228884567-228884589 CAGGAAATGTTTGCTGTTGCTGG + Intergenic
923100868 1:230815775-230815797 TAGGAAGTTTCTACTGCTGCTGG + Intergenic
1064208043 10:13341462-13341484 CAAGTAATGATTGCTGCTGCTGG - Intronic
1064900219 10:20287889-20287911 CAGGAATTTACTACTGTTTCTGG + Exonic
1064901329 10:20298623-20298645 CAGGAAGCTACTGCTTCAGCTGG + Intergenic
1065639492 10:27767406-27767428 CAAGAAACCACTACTGCTGCTGG + Intergenic
1066314463 10:34230292-34230314 CAGGTAGTACCTGCTGCTGCTGG - Intronic
1067045494 10:42982987-42983009 CCAGAAACTTCTGCTGCTGCGGG - Intergenic
1067261886 10:44700030-44700052 CAGGAACATGCTGCTGCTGAGGG + Intergenic
1067697150 10:48543588-48543610 CTGGACAATACTGGTGCTGCTGG - Intronic
1069313040 10:67062908-67062930 CAGGAAATTGCTGCTGATCTTGG - Intronic
1074276228 10:112005132-112005154 TGGGAAATTACTGCTGGTCCTGG + Intergenic
1079216265 11:18514969-18514991 CAGGAAATAAATTCTGCTGGGGG - Intronic
1083213413 11:61203564-61203586 CATGAAGTGGCTGCTGCTGCTGG + Exonic
1083216297 11:61222400-61222422 CATGAAGTGGCTGCTGCTGCTGG + Exonic
1083219179 11:61241226-61241248 CATGAAGTGGCTGCTGCTGCTGG + Exonic
1083366761 11:62145933-62145955 CCTCAAATTACTGCTGCTACAGG - Intronic
1084655283 11:70511590-70511612 CAGGTAAGTACTGCAGCTCCTGG + Intronic
1084915467 11:72425913-72425935 CAGGAAACTACAGGGGCTGCAGG - Intronic
1084992933 11:72945887-72945909 CAGGAAACAACTGGTGCTGGAGG + Intronic
1087038799 11:93778805-93778827 CAGGAAACAACAGGTGCTGCTGG - Intronic
1088163364 11:106901318-106901340 GAGGAAGTTACTGCAGATGCTGG - Intronic
1088734709 11:112719164-112719186 CAGGAAATCACTGATGCTGAAGG + Intergenic
1088971787 11:114780393-114780415 CAGGAAATGGGTGCTGATGCTGG + Intergenic
1093636832 12:21480711-21480733 AAGGAAAGAAGTGCTGCTGCAGG - Intronic
1094352480 12:29542409-29542431 AAGGAAATTCCAGATGCTGCAGG - Intronic
1098024367 12:66187224-66187246 CAGGAAATCACTGCAGATGAGGG - Intergenic
1098030083 12:66244590-66244612 CAGATGTTTACTGCTGCTGCTGG - Exonic
1098059745 12:66548769-66548791 CAGGAAGTTTGTGTTGCTGCGGG + Intronic
1098539008 12:71630599-71630621 GAAGAAATTACTGCTTCAGCAGG - Exonic
1099422167 12:82474224-82474246 CAGGAAGTTTCTGCTGCTTTGGG + Intronic
1104175608 12:126329289-126329311 CAGGCAAGTAGTGCTGATGCAGG - Intergenic
1104183108 12:126401372-126401394 ATGGACATTTCTGCTGCTGCGGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1107006533 13:35618888-35618910 CAGCAGATTCCTGGTGCTGCTGG + Intronic
1107490139 13:40873846-40873868 GAGGACATCACTGTTGCTGCAGG - Intergenic
1107660224 13:42631606-42631628 CAGAAAATTACAGCTTTTGCAGG - Intergenic
1107892967 13:44930409-44930431 CTGGAAGCAACTGCTGCTGCCGG - Intergenic
1110209317 13:72953616-72953638 CAGTACATTACTGCTACTGCTGG - Intronic
1111628449 13:90818666-90818688 CAGGAAAAAACAGATGCTGCAGG + Intergenic
1113650657 13:112032042-112032064 CAGCAACCTACTGCTGCTGTTGG + Intergenic
1115491195 14:33959989-33960011 CAGGAAGCTGCTGATGCTGCTGG - Intronic
1116873755 14:50091670-50091692 GAGGGAAGTGCTGCTGCTGCCGG - Exonic
1117147456 14:52849455-52849477 CCTGTAATTACTGCTTCTGCTGG + Intergenic
1118389399 14:65283606-65283628 CTGGAAATATCTGCTGCTCCAGG + Intergenic
1120105633 14:80490997-80491019 CCAGATAATACTGCTGCTGCAGG + Intronic
1120497048 14:85250636-85250658 CAGATAAGCACTGCTGCTGCTGG - Intergenic
1121820569 14:96962476-96962498 CAGGAAGGAACTGCTGCTGCTGG + Intergenic
1121907745 14:97762699-97762721 GAGTCAATTGCTGCTGCTGCTGG - Exonic
1122088912 14:99325240-99325262 CAGGGAACTGCTGCAGCTGCAGG + Intergenic
1123961936 15:25412105-25412127 AAACAAATTACTGCTGTTGCCGG + Intronic
1124687296 15:31793149-31793171 AAGGACATTCCTGCTGCTTCCGG - Intronic
1125423286 15:39525794-39525816 CATGAAAATACTCCTGCTCCTGG - Intergenic
1126032687 15:44515382-44515404 CAGGAAAACACTGCATCTGCTGG - Intronic
1128987956 15:72234957-72234979 CAGGCAATCAGTTCTGCTGCGGG - Intergenic
1129193456 15:73951147-73951169 CAGGGAATCCCTCCTGCTGCTGG + Intronic
1129443187 15:75597365-75597387 CAGGACACTAGTGCTGCTGGAGG + Intergenic
1130841229 15:87703129-87703151 TAGGAAGGTACTGGTGCTGCAGG + Intergenic
1133096509 16:3450402-3450424 CAGGAAAGTTGTGCTCCTGCTGG + Intronic
1133612481 16:7446655-7446677 CAGGGAGTTACTGAGGCTGCTGG - Intronic
1133711219 16:8403096-8403118 CAGTCAATAACAGCTGCTGCTGG + Intergenic
1136591990 16:31223153-31223175 CATGAAAATGCTGCTGCTGTTGG + Intronic
1138426512 16:56937106-56937128 TAGGAAATTAGTGCTGCTGCAGG + Intronic
1138658356 16:58503396-58503418 CAGGCACTTCCTGCTGCTGCAGG - Intronic
1139308805 16:66010999-66011021 CAAGGAATTACTGCTTCTGCGGG + Intergenic
1141661842 16:85445706-85445728 CAGGAGAGGGCTGCTGCTGCTGG - Intergenic
1144732767 17:17538009-17538031 CAGGAAGGGACAGCTGCTGCCGG + Intronic
1150086526 17:62276019-62276041 AGGGAAGTGACTGCTGCTGCTGG + Intronic
1152579594 17:81160145-81160167 CAGGAGACTCCTGCTCCTGCAGG - Intronic
1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG + Intronic
1154256821 18:12788874-12788896 CAGAAAATTCCTGCTGCCGAGGG + Intronic
1154974782 18:21446501-21446523 CAGGAAAGAACTGATCCTGCAGG - Intronic
1155002745 18:21703397-21703419 CAGGAAAATACCCCAGCTGCAGG - Intronic
1155569986 18:27183072-27183094 CTAGAAATTAGTGCAGCTGCAGG - Intronic
1156355024 18:36333286-36333308 CAGGTAAAGACAGCTGCTGCTGG + Intronic
1156508997 18:37619678-37619700 CATGAAATTTCAGCTCCTGCAGG - Intergenic
1157005489 18:43578892-43578914 GAAGAAATTGCTGCGGCTGCTGG - Intergenic
1159539383 18:69755982-69756004 CAGGAAATCACACCTGATGCAGG - Intronic
1161699304 19:5786282-5786304 CTGGAAATTGCTGCTGCTGTGGG - Intronic
1163807402 19:19407454-19407476 CAGGAAATTGGGGCTGCTGGAGG + Intronic
925235219 2:2272060-2272082 GAGGGCATTACTGCTGCTGGTGG - Intronic
926368382 2:12154872-12154894 CAGGAGCTCACAGCTGCTGCTGG - Intergenic
927678425 2:25123876-25123898 CAGGAAACTCCTGATCCTGCTGG - Intronic
929028979 2:37633399-37633421 CAGGAAATTACTGTGGTAGCAGG - Intergenic
930099593 2:47592678-47592700 CAGGGTAATTCTGCTGCTGCAGG + Intergenic
930442046 2:51421027-51421049 AAGAAAATTACTCCTGCTGGTGG + Intergenic
931499021 2:62843027-62843049 AAGAAAATTACTGCTCTTGCAGG - Intronic
933865234 2:86509977-86509999 CAGCAAACTACAGCTGCTGCAGG + Intronic
933943890 2:87267778-87267800 CAGGTGATATCTGCTGCTGCCGG + Intergenic
935378408 2:102423604-102423626 CAGGAAACCAGGGCTGCTGCTGG + Intronic
935571811 2:104670061-104670083 CAGTAGATAACAGCTGCTGCTGG - Intergenic
936336330 2:111593801-111593823 CAGGTGATATCTGCTGCTGCCGG - Intergenic
937821038 2:126311424-126311446 CAGGAAATTCCTACTGTTGGTGG - Intergenic
938501206 2:131832032-131832054 CTGGAAACTTCTGCTGGTGCCGG - Intergenic
938584791 2:132679555-132679577 CTGGAAAATTCTGGTGCTGCAGG + Intronic
938624345 2:133091928-133091950 AAGAAATTTATTGCTGCTGCTGG - Intronic
938922727 2:136009765-136009787 CAGGATGCTGCTGCTGCTGCTGG + Intergenic
942325289 2:174771368-174771390 CAGTAAATAACTGCTGATGAGGG + Intergenic
942631340 2:177952865-177952887 CAGGCAATTACTGCTTTTCCTGG + Intronic
942950378 2:181714334-181714356 GAGTAAATTGCAGCTGCTGCTGG + Intergenic
943945162 2:194051800-194051822 CAGGAAATAACAGATGCTGGAGG + Intergenic
946745219 2:222838722-222838744 TAGGACATTACTGTTGTTGCTGG - Intergenic
948168375 2:235880380-235880402 CAGGAGATTACAGATGCTCCAGG - Intronic
948202044 2:236136375-236136397 AAGAAAATTGCTGCTGCAGCTGG - Intergenic
948308647 2:236968795-236968817 GAGGAACTTTCTGATGCTGCAGG - Intergenic
1168930635 20:1620546-1620568 CAGGAAATAATTCCTTCTGCTGG - Intergenic
1169077560 20:2770630-2770652 AGGGAAATTAGTGTTGCTGCCGG - Intergenic
1169531415 20:6489272-6489294 CTTGAAATTGCTGCTGCTACGGG + Intergenic
1171048797 20:21836602-21836624 CAGGAGATAACCGATGCTGCTGG + Intergenic
1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG + Intergenic
1171570909 20:26251135-26251157 CAGGCAATCACTGAGGCTGCGGG + Intergenic
1172507711 20:35475978-35476000 AAGGCAATTACTGCTGTGGCAGG - Intronic
1172973973 20:38893226-38893248 CATGCTATTACTGTTGCTGCCGG + Intronic
1173851762 20:46222942-46222964 CAGGAATATTCTGCTGATGCGGG - Intronic
1173919252 20:46731553-46731575 CAGGATGTGACTGCAGCTGCGGG + Intronic
1175308525 20:57994858-57994880 CAGGAAACTGCTGCTGAAGCTGG - Intergenic
1175584336 20:60126084-60126106 CAGGAAGCCCCTGCTGCTGCAGG + Intergenic
1179320409 21:40285937-40285959 CAGGGGATCACTGCTGCTTCAGG + Intronic
1179338475 21:40481166-40481188 CAGGAAGTGACTTTTGCTGCAGG - Intronic
1180573075 22:16748148-16748170 CAGGCAATCACTGAGGCTGCGGG + Intergenic
1181286771 22:21758211-21758233 CAGGAAATGCCTGGAGCTGCTGG - Exonic
1181888126 22:26037805-26037827 CTGGAAATTATTCTTGCTGCTGG + Intergenic
1182930255 22:34166986-34167008 CAGGAGCTTACTCCTCCTGCAGG + Intergenic
1185328457 22:50239630-50239652 CAGGAAAAAGCTGCTGCAGCTGG + Intronic
1185362819 22:50419188-50419210 CAGGACACTCCTGCTGCTGCTGG - Intronic
949968558 3:9381473-9381495 CAGGACAATGCTGATGCTGCTGG + Intronic
952257089 3:31705014-31705036 GAGGAAATTAAGGCTGGTGCAGG + Intronic
952502747 3:33979113-33979135 CAGGATCTTACTGCATCTGCTGG + Intergenic
953537987 3:43790338-43790360 CAGAAACTGGCTGCTGCTGCAGG + Intergenic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
955328158 3:58025498-58025520 CAGGACCTTACTGCCGCTGCTGG - Intronic
955665911 3:61348930-61348952 CAGGAAGCTCCTGCTGCAGCTGG - Intergenic
956160306 3:66344696-66344718 CTGGACATTACTTCAGCTGCTGG + Intronic
958912328 3:100008106-100008128 CAATAAATTGCTGCTGCTGTTGG + Intronic
959421691 3:106136187-106136209 GCAGAAACTACTGCTGCTGCTGG + Intergenic
966668106 3:182495625-182495647 CAGAAAAGTACTGAGGCTGCTGG - Intergenic
966890632 3:184405218-184405240 CAGGAGATTCCTGAGGCTGCTGG - Intronic
966955564 3:184874671-184874693 CAGGAAAGTACTGGTACTACTGG + Intronic
967678870 3:192335629-192335651 TAGGTAATTAATGCTGGTGCAGG - Intronic
971066509 4:23038804-23038826 CAGAAAATGACTTCTGCAGCTGG + Intergenic
972385602 4:38562802-38562824 CGGCAACTTCCTGCTGCTGCTGG - Intergenic
972632582 4:40855146-40855168 CAAGAAGATACTGCTGCTGATGG - Intronic
974585106 4:63863953-63863975 CAGGAAACAACTGATGCTGGAGG + Intergenic
975217554 4:71773372-71773394 CAGGAAATCTTTGCTGCTTCAGG + Intronic
979441049 4:120749842-120749864 CAGGAGAGGTCTGCTGCTGCGGG + Intronic
979716863 4:123850562-123850584 CGGAAAATTGCAGCTGCTGCTGG - Intergenic
982254853 4:153441860-153441882 CAGGTGATTTCTACTGCTGCTGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
984873429 4:184347196-184347218 CAGGAAAGCAGTGCTGGTGCTGG + Intergenic
984937639 4:184903198-184903220 CAGGACATTTCAGCAGCTGCTGG + Intergenic
986896398 5:12375415-12375437 CAGGAAGATAATTCTGCTGCTGG - Intergenic
996314445 5:122146024-122146046 CTGAAAAGAACTGCTGCTGCTGG + Intronic
997114329 5:131109802-131109824 CAGGAACTTGATGCTGATGCTGG - Intergenic
998940710 5:147279887-147279909 AAGGAAACGACTGCTCCTGCAGG + Intronic
999071453 5:148747923-148747945 CAGGAAATAATTGATGCAGCCGG + Intergenic
1000475916 5:161706631-161706653 CCCGAAACAACTGCTGCTGCCGG + Intergenic
1001664856 5:173424133-173424155 CAGGACATTCCTCCTGGTGCTGG + Intergenic
1002865109 6:1115033-1115055 AAGGACATTACTGCAGCTGGGGG - Intergenic
1004015798 6:11730828-11730850 CAGAAACCTACTGATGCTGCAGG - Intronic
1004579938 6:16940312-16940334 TAGGAAACTCCTGCAGCTGCCGG - Intergenic
1004828691 6:19452717-19452739 CAGGGCATTGCTGCTGGTGCTGG - Intergenic
1007113543 6:39327639-39327661 CAGGGAATTATTGCTGCTAATGG + Intergenic
1008177733 6:48288961-48288983 CAACACATTACTGCTGCTGGGGG + Intergenic
1008384211 6:50869570-50869592 CAAGGAACTACTGCTGCTGAAGG - Intergenic
1008428032 6:51381568-51381590 CCGGGTATTACTGATGCTGCTGG + Intergenic
1010247552 6:73675748-73675770 CAGGAAAAGCCTGCTGCAGCTGG - Intergenic
1010793552 6:80092677-80092699 CAAGATATTTCTCCTGCTGCAGG + Intergenic
1012447594 6:99322512-99322534 CTGGAAATTACTGCAGATGAGGG + Intronic
1013705952 6:112834110-112834132 TAGGCAGTAACTGCTGCTGCTGG - Intergenic
1013773054 6:113648823-113648845 TAGGAGATTACTGCTACTCCAGG + Intergenic
1014982714 6:127964405-127964427 CAGGAAGGTAGTGCTGCTGCAGG + Intergenic
1015793675 6:136989517-136989539 CAGAAAATCACAGCTGCTTCAGG - Intergenic
1017408860 6:154148408-154148430 CTGCAAGCTACTGCTGCTGCTGG - Intronic
1018448211 6:163877967-163877989 CCAGAACTTACTGATGCTGCTGG - Intergenic
1018484418 6:164226684-164226706 TATGAAATTCCTGCTGCAGCGGG - Intergenic
1019615568 7:1958144-1958166 CAGGAAAGGACTTCTACTGCGGG + Intronic
1023743337 7:43300691-43300713 AAGGAAAGTGCTGCTGCTGCTGG + Intronic
1025285229 7:57655180-57655202 CAGGCAATCACTGAGGCTGCGGG + Intergenic
1026063645 7:67049150-67049172 CAATAAATTAGAGCTGCTGCTGG - Intronic
1026714699 7:72778309-72778331 CAACAAATTATAGCTGCTGCTGG + Intronic
1034312528 7:150101385-150101407 CAGGAAATTAATTCTGCATCTGG + Intergenic
1034794328 7:153999274-153999296 CAGGAAATTAATTCTGCATCTGG - Intronic
1035393498 7:158521083-158521105 CAGGAAGTCACTGCGTCTGCAGG - Intronic
1041036553 8:53797329-53797351 TGGGAAAGAACTGCTGCTGCCGG - Intronic
1041206675 8:55506442-55506464 CATGAAGTCAGTGCTGCTGCTGG - Intronic
1042293574 8:67195521-67195543 CAGGAATCTGCTGCTGCTCCTGG - Exonic
1046733060 8:117746615-117746637 CAGGAATTATCTGCTGCTCCAGG + Intergenic
1047022122 8:120785953-120785975 CAGTACATTACTACTACTGCTGG + Intronic
1048454368 8:134564682-134564704 CTGAGAATTACTGCTGTTGCTGG - Intronic
1049180392 8:141219182-141219204 CAAGAAACTGCAGCTGCTGCTGG + Intronic
1051056754 9:12996479-12996501 CAAGAAATTCCAGGTGCTGCTGG - Intergenic
1058032074 9:100210989-100211011 CTGGGAAGTGCTGCTGCTGCTGG - Intronic
1059778578 9:117502132-117502154 CAGAAAATAACTGATGCTGGTGG - Intergenic
1060185594 9:121562190-121562212 CTGGGAATTCCTGCTGCTGCTGG + Intergenic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1203412936 Un_KI270589v1:12442-12464 CAGGAAACAACAGGTGCTGCAGG + Intergenic
1203685257 Un_KI270757v1:47429-47451 CAGGAAACAACAGGTGCTGCAGG - Intergenic
1186526001 X:10248858-10248880 CAGCAAATCGCTGCTGCTGTTGG + Intergenic
1186712441 X:12213502-12213524 CAGGATATTAATGCTGCTTTTGG - Intronic
1187558146 X:20372733-20372755 CAGGAATTTACTGCTACCACAGG + Intergenic
1188883624 X:35522092-35522114 CAGAAAATTACTGTTGGGGCCGG + Intergenic
1189307311 X:39996619-39996641 CAGCACATTACTGCTGCTGAGGG - Intergenic
1190283326 X:48945908-48945930 CAGGAAAGGTCTGCTGCTTCTGG - Intronic
1190515353 X:51218232-51218254 CAGGCAAGCACTGCTGCTTCCGG + Intergenic
1194033076 X:88839682-88839704 CAGGAAATTACTGATGCCAGTGG + Intergenic
1194048345 X:89036393-89036415 CAGTACATTACTACTGCAGCTGG - Intergenic
1198559264 X:137830964-137830986 CATCAAATAACTGCTGCTGTGGG - Intergenic
1199541926 X:148967031-148967053 CCGGACATTAGTGCTGCTGCTGG - Exonic