ID: 1153473600

View in Genome Browser
Species Human (GRCh38)
Location 18:5472720-5472742
Sequence TGTAACCTATAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153473600 Original CRISPR TGTAACCTATAGAAGTTGGA AGG Intronic
902284722 1:15400021-15400043 TTTCACCTAGAGAAGCTGGAAGG - Intronic
903689587 1:25163214-25163236 TGTAAACTATAGACTTTGGGTGG + Intergenic
909400079 1:75218279-75218301 AGTAACCTATAGCATTTAGAAGG + Intronic
910321548 1:85950847-85950869 TGTAAACTCAAGAAGTTGGGTGG + Intronic
911205576 1:95088981-95089003 TGTTACCTATTTAACTTGGAAGG + Intergenic
912134762 1:106647566-106647588 TGTGACAAATAGAAGTTGAAGGG - Intergenic
912930860 1:113959646-113959668 TGTAAACTAATGAAGTTAGAGGG + Intronic
916775471 1:167958889-167958911 TGTAAACTATGGACTTTGGATGG - Intronic
923356177 1:233157969-233157991 TGTATCCCATAGAAGTAGGCTGG - Intronic
1063846344 10:10131718-10131740 TGCAGACTATAGAAATTGGAAGG - Intergenic
1066080512 10:31927446-31927468 TCTAACCTCTAGAAGTCGGGTGG + Intronic
1066702103 10:38141247-38141269 TTTAACATATAGAGGATGGAAGG + Intergenic
1068916881 10:62442548-62442570 TGTTACCTTTAGAAGTTTGGAGG + Intronic
1069612931 10:69787376-69787398 TGTGACAGATAGAAGGTGGAGGG + Intergenic
1070016568 10:72539265-72539287 TGTATTCTGTAGCAGTTGGATGG - Intronic
1070570263 10:77636014-77636036 TGTGCCCTGTAGAAGTTTGAGGG + Intronic
1070923634 10:80204611-80204633 TGTTACCTAGAGACTTTGGAGGG - Intronic
1072528129 10:96292814-96292836 TGTAAACTACAGAATTTGGGTGG - Intergenic
1073402355 10:103268681-103268703 TTAAACCTAGAGAAGTTGCAAGG + Intergenic
1074167249 10:110893315-110893337 AATATCTTATAGAAGTTGGAAGG + Intronic
1074378048 10:112954667-112954689 TGTAACCTATTAAAGTTGATTGG + Intronic
1077183800 11:1227701-1227723 GGGAACCTGCAGAAGTTGGATGG + Exonic
1078665671 11:13323135-13323157 TGTCAGCTGTAGAAGTAGGAAGG + Intronic
1080481608 11:32657179-32657201 TGTAACATGTAGAACTTTGAAGG - Intronic
1081113674 11:39170686-39170708 TGTAGACTATATAAGTTTGATGG - Intergenic
1082644406 11:55703324-55703346 TGTAACTTGTAGGAGTTGGAGGG + Intergenic
1083035145 11:59629951-59629973 TATAACCTTTTGAAGTAGGATGG - Intergenic
1084794194 11:71493655-71493677 TGTGACCTAAGGAAGTTGGAGGG - Intronic
1087526942 11:99326880-99326902 TGTAACAAATAGAACTTTGATGG - Intronic
1088445596 11:109923862-109923884 TGTATTCTATAGCTGTTGGATGG - Intergenic
1092317032 12:7427780-7427802 TGAAACCTCTATAATTTGGAAGG - Intronic
1094531593 12:31280271-31280293 GGGAAACTATAAAAGTTGGAAGG - Intergenic
1096470014 12:51869754-51869776 TGTGACCTATACAAGGTGGGAGG + Intergenic
1096941631 12:55352883-55352905 TGTGACCTAAATCAGTTGGATGG - Intergenic
1097448436 12:59705639-59705661 TGCAACATTTAGAAGTGGGATGG - Intronic
1097627037 12:62012520-62012542 TGTAAGCAATGGAAGTTTGAAGG - Intronic
1100252526 12:92842936-92842958 TTTATGCTATAGAAGTTGGGAGG - Intronic
1100527062 12:95429514-95429536 TGAAACATATAGAAATTTGATGG + Intergenic
1101711008 12:107266405-107266427 TAAAACCTATAGAAGGTAGAAGG + Intergenic
1103884386 12:124189775-124189797 TGGAACCTTTAGAAGCTGGAAGG - Intronic
1105395826 13:20033439-20033461 TGTAATTTATAGAAGGAGGAAGG - Intronic
1105710309 13:23001608-23001630 TGTAGACTATAGAAGCTCGATGG + Intergenic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1111345806 13:86952132-86952154 TGTAACATAATGAAGCTGGAAGG - Intergenic
1116718727 14:48464323-48464345 TGTGGCCTATAGCAGTTGGCGGG + Intergenic
1119167290 14:72505109-72505131 TGTAATGAATAGAAGCTGGAAGG - Intronic
1120357192 14:83449768-83449790 TGCAGCCTCTAGAAGCTGGAAGG + Intergenic
1123773213 15:23549918-23549940 TGTAATCTCTATAATTTGGAAGG - Intergenic
1125267516 15:37900405-37900427 TGCAACCCCTAGAATTTGGAGGG + Intergenic
1127173302 15:56326845-56326867 GGTAGCCATTAGAAGTTGGATGG + Intronic
1133898415 16:9950556-9950578 TGTAGCCTATTCAAGTTGTAGGG - Intronic
1139727925 16:68916915-68916937 TGTAAACTATGGACGTTGGGTGG - Intronic
1143554920 17:7654035-7654057 TGTAAGCTAAAGAGGTGGGAGGG - Exonic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1149810334 17:59663356-59663378 TGTAACCTATATATGTCTGAGGG - Intronic
1150432629 17:65130660-65130682 TGTACCCTACAGAATTGGGAAGG + Intergenic
1153473600 18:5472720-5472742 TGTAACCTATAGAAGTTGGAAGG + Intronic
1155387596 18:25296516-25296538 TTTAACCTGTGGAAATTGGAGGG + Intronic
1156241431 18:35258387-35258409 TGTAACAGATAACAGTTGGAGGG + Intronic
1157169271 18:45387156-45387178 TGTAACATACAGAAGTTGTAAGG - Intronic
1159022139 18:63151986-63152008 TTTAATCTATAGCAGTTGGCAGG + Intronic
1160135414 18:76267113-76267135 TTTGACCTATAGAAGGTGCATGG - Intergenic
1165022036 19:32933072-32933094 TTTAACCTATAAAAGTAGCAAGG + Intronic
1165180311 19:33961920-33961942 TGTAACTTATGAGAGTTGGAAGG - Intergenic
926225161 2:10961914-10961936 TGTCACCTGAAGAGGTTGGATGG + Intergenic
929291759 2:40200458-40200480 TGTAACATCTGGAACTTGGAAGG + Intronic
933805836 2:85997606-85997628 TAAAACCTATAGAGATTGGAAGG + Intergenic
935782328 2:106519082-106519104 TGAGGCCTATAGAAGATGGATGG - Intergenic
936631514 2:114208026-114208048 TGGAGACTACAGAAGTTGGAAGG - Intergenic
941116487 2:161478670-161478692 TGTAACTTATAAAAGTTGAAGGG - Intronic
944354482 2:198769746-198769768 TGTAAAATATAGAACTTTGAAGG - Intergenic
945724690 2:213462358-213462380 TGCAATCTCTAGAAATTGGATGG + Intronic
1172373357 20:34414841-34414863 TGTAGCCTACAGAAGTAGAAGGG - Intronic
1175129613 20:56779603-56779625 GGTCACCTATAGAGGATGGAAGG - Intergenic
1177489717 21:21806539-21806561 TCTATCCTATAAAAGTGGGAAGG - Intergenic
951133540 3:19076469-19076491 TATAAACTATGGAATTTGGATGG + Intergenic
951940545 3:28073789-28073811 GTAAACCTATAGAAGTTGCATGG + Intergenic
952568029 3:34681562-34681584 TGGAAGCTTCAGAAGTTGGAAGG + Intergenic
956884895 3:73549351-73549373 TGTACCCGAGAGAAGTTGCATGG + Intronic
959433049 3:106278524-106278546 TGTATTCTGTAGAAGTTGGGAGG + Intergenic
961344488 3:126254696-126254718 TGTAAACAATAGAAGTGGAAAGG + Intergenic
961549091 3:127657058-127657080 TGAAGCCCAGAGAAGTTGGAGGG + Intronic
962167654 3:133066618-133066640 AGTAAACTATAGAAGAAGGAAGG - Intronic
963390119 3:144651018-144651040 TGTAAGCTGTCAAAGTTGGAAGG - Intergenic
964073832 3:152668689-152668711 TGTAACATATAGCCTTTGGAGGG + Intergenic
964866475 3:161268109-161268131 TGAAGCCCATAAAAGTTGGATGG + Intergenic
965835804 3:172851069-172851091 GGTTACCTACAGAAGTTGGTGGG + Intergenic
969296708 4:6274524-6274546 TGTAACCTCTAGCAGAGGGAGGG + Intronic
970827150 4:20289806-20289828 TGTGACCTACAGAGGTTGGAGGG + Intronic
973962620 4:56126971-56126993 TTTAACCTATAAATTTTGGAAGG - Intergenic
974571033 4:63649196-63649218 TGAAAACTATAGAAGTTGGTAGG + Intergenic
975194104 4:71502795-71502817 TGTATTCTGTAGCAGTTGGATGG + Intronic
975722984 4:77266147-77266169 TGTCACCTATTGAGGTTAGATGG - Intronic
979353401 4:119673080-119673102 TGTAAGGTATAGAAGTGGCAAGG + Intergenic
981594136 4:146400034-146400056 TGTAACCTCTAAATGTTAGAGGG - Intronic
983160647 4:164410044-164410066 TGTAACTTATACAAATTGAAAGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
987805834 5:22766627-22766649 TGGAACCCACAGGAGTTGGAAGG - Intronic
990489614 5:56291378-56291400 TTTAAGATATTGAAGTTGGAAGG + Intergenic
990641264 5:57786434-57786456 TGTAACGTGAAGAAGTTGGGTGG - Intergenic
991962211 5:72056483-72056505 TGCTATCTATGGAAGTTGGATGG + Intergenic
992460957 5:76959838-76959860 TGTAAAATATAGAAGATGAAAGG + Intronic
993448179 5:88040349-88040371 TGTAACCTATGGATTTTGGCAGG + Intergenic
993962669 5:94319287-94319309 TCCAACATTTAGAAGTTGGAAGG - Intronic
993987538 5:94615302-94615324 TATAACATATAGGAGTTTGATGG - Intronic
994225241 5:97244481-97244503 TGTAACAAATAGAAGTTGAGTGG + Intergenic
998315214 5:141176895-141176917 TGGAACGTAAAGATGTTGGAGGG + Intergenic
999348378 5:150844346-150844368 GGTAACCTATGGAATCTGGAGGG - Intergenic
1000420801 5:161035864-161035886 TGTAACCCACAGAGCTTGGAAGG - Intergenic
1000576608 5:162982776-162982798 TGTAACCTAGGGAGGCTGGAGGG - Intergenic
1001292870 5:170476944-170476966 TGTAAACTATAGACTTTGGGTGG + Intronic
1005526234 6:26652752-26652774 TGTAACCTATGGAGTTTGGGTGG + Intronic
1009040338 6:58168325-58168347 TGTAACCTTTGTAAGTTGGAGGG - Intergenic
1009216191 6:60922862-60922884 TGTAACCTTTGTAAGTTGGAGGG - Intergenic
1013542876 6:111128688-111128710 TGTTCCTTATAGAAGATGGAAGG + Intronic
1013567245 6:111379345-111379367 TCTAGCCTATAGAAGTTTAAAGG + Intronic
1014015403 6:116524222-116524244 TGGAAACTATTGAAGCTGGATGG + Exonic
1024372293 7:48599883-48599905 TGTATTCTGTAGTAGTTGGATGG + Intronic
1025739942 7:64186396-64186418 TGTCACCTGTAGAAGCAGGATGG + Intronic
1027588278 7:80085566-80085588 TTTAACTTATAGAACATGGAAGG - Intergenic
1027684169 7:81261077-81261099 TGTAAACTATGGAAGTTGAGTGG - Intergenic
1029876707 7:103761906-103761928 AGTAACATTTAGAGGTTGGAAGG + Intronic
1031018103 7:116597352-116597374 AGTTTCCTATGGAAGTTGGAGGG + Intergenic
1039329047 8:36516238-36516260 TGAAATCTGTAGAAGTCGGAAGG - Intergenic
1042106138 8:65328228-65328250 TGTAACAGATAGAAGTAGAAAGG + Intergenic
1044419578 8:91978773-91978795 TGCAGCCCATAGAAGGTGGAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045637281 8:104206920-104206942 TGCAAGCTATTGAAGCTGGAAGG + Intronic
1048405733 8:134118290-134118312 TGATTCTTATAGAAGTTGGATGG + Intergenic
1048781209 8:138004049-138004071 GGTAACCTCTAGGAGTTGAATGG - Intergenic
1050333535 9:4569286-4569308 TGCAACCTTTATAAGTGGGATGG + Intronic
1052259431 9:26495203-26495225 TGTAAACTTTAAAAGTTGAAAGG + Intergenic
1052482114 9:29044254-29044276 TGGAGCAAATAGAAGTTGGAAGG + Intergenic
1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG + Intergenic
1059518438 9:114917262-114917284 TGTAACCTTTAGAACCTAGATGG - Intronic
1060009397 9:120030290-120030312 TGCAACCTCTAGAAGCTGAAAGG - Intergenic
1185914781 X:4023875-4023897 TGTAACTGATTGAAATTGGAAGG - Intergenic
1186762717 X:12740189-12740211 TGTAACCAATAGAATTTGGTGGG - Intergenic
1195779768 X:108449195-108449217 TGCTACCTAGAAAAGTTGGAGGG + Intronic
1196034762 X:111132219-111132241 TGTCACCCATAGGAGGTGGATGG + Intronic
1196835558 X:119810763-119810785 GGAAACCAAAAGAAGTTGGAAGG - Intergenic
1197960524 X:132000565-132000587 TTTATCCCAAAGAAGTTGGAGGG + Intergenic
1198027240 X:132719182-132719204 AGAAACCTATCAAAGTTGGAAGG + Intronic
1198576388 X:138014497-138014519 TGTAACCAACTGAAGTGGGACGG - Intergenic
1201277752 Y:12314455-12314477 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1201357641 Y:13113762-13113784 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1202052641 Y:20796981-20797003 TGAAAGCTTCAGAAGTTGGAAGG - Intergenic