ID: 1153474841

View in Genome Browser
Species Human (GRCh38)
Location 18:5488260-5488282
Sequence TGTCCTTTTCAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 2, 1: 10, 2: 32, 3: 65, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153474837_1153474841 16 Left 1153474837 18:5488221-5488243 CCATGGAATACTATGCAGCTATA 0: 436
1: 25124
2: 14091
3: 8335
4: 5529
Right 1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG 0: 2
1: 10
2: 32
3: 65
4: 290
1153474836_1153474841 27 Left 1153474836 18:5488210-5488232 CCACTAAGAAACCATGGAATACT 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG 0: 2
1: 10
2: 32
3: 65
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153474841 Original CRISPR TGTCCTTTTCAGGACATGGA TGG Intronic
900105968 1:981163-981185 TCTTCCTTTCAGGGCATGGATGG - Intronic
901560217 1:10064184-10064206 TTTCTTTTTCAGGACAGGTAGGG - Intronic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
903377569 1:22876387-22876409 TTTCCTTCTCAGGGCATGCAGGG - Intronic
904227288 1:29033081-29033103 TTTCTTTTTCAGGACTTGGAAGG + Exonic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906262544 1:44405479-44405501 CGCACTTTTCAGGACACGGAGGG - Exonic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907002516 1:50875917-50875939 TGTCTTTTTGAGGAAAAGGATGG - Intronic
909460160 1:75902506-75902528 TGTCCTTTACACAACATAGATGG - Intronic
911239792 1:95452629-95452651 TGTCCTATTCAGGATTTTGACGG + Intergenic
911239925 1:95453924-95453946 TGTCCTATTCAGGATTTTGATGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914740117 1:150457423-150457445 TCTCCTTTTCAGGGAATGGGAGG + Exonic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
1063602192 10:7492389-7492411 TGACATTTTCAGTGCATGGATGG - Intergenic
1064532532 10:16324824-16324846 TTTTCTTTTCAGCACTTGGATGG + Intergenic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1066179932 10:32951423-32951445 TTTTTTTTTCAGGACAGGGAGGG - Intronic
1066228444 10:33407834-33407856 CGTCCTTTTAAGAGCATGGAGGG - Intergenic
1067149142 10:43715313-43715335 TGTGCTTTTCAGTACCTGGCAGG - Intergenic
1068199865 10:53769278-53769300 TGTTCTTTTAAGGAAATAGAGGG - Intergenic
1068811140 10:61257190-61257212 TGTCAGTTTTAGAACATGGATGG + Intergenic
1069147605 10:64915392-64915414 GGTCCTTTTCATGACATGTGGGG + Intergenic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070319026 10:75340563-75340585 TGTCCTTTTCAATAGATGCATGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074923527 10:118044914-118044936 TGTCCTTTTAAGTTTATGGAAGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1078407175 11:11080536-11080558 TCTCCTTTTTAGCACATGGGCGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079064937 11:17281485-17281507 TTTCCTTTTCAAGACAAGAAGGG + Intronic
1079259676 11:18866270-18866292 TTTCCTTTTCAGGACAACGAAGG - Intergenic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1081644410 11:44779560-44779582 TGGCCTTGTGAAGACATGGATGG + Intronic
1081826638 11:46060166-46060188 TGACTTTTTCAAAACATGGATGG + Intronic
1082116568 11:48335975-48335997 TGTCCTTTTAAAAACATGGTTGG + Intergenic
1082257225 11:50044335-50044357 TGTCCTTTTAAAAACATGGTTGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1084440481 11:69169972-69169994 TGTCCTTCTGAGGACATGACAGG - Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1089924217 11:122240276-122240298 TTTCCTATTCAGGACAGGGCTGG - Intergenic
1090456669 11:126855965-126855987 TGTCCTTTTCAAGAAATTCAAGG - Intronic
1090490053 11:127152411-127152433 TGTCATTTACAGGACATCTAAGG + Intergenic
1090553006 11:127842952-127842974 TGTCACTGTCAGTACATGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091135566 11:133185791-133185813 TGTTCTTTTCAAGTCATGGTGGG - Intronic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1093566720 12:20615295-20615317 TGTCCTGTTTAGGATATGGTGGG + Intronic
1095877375 12:47096522-47096544 TGTCCTCTTAAGCACATTGAGGG + Intronic
1097419318 12:59354369-59354391 TGTCCTTTCAGAGACATGGATGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098002733 12:65962248-65962270 AGTACCTTTCAGGACATGGGTGG - Intronic
1099374867 12:81886782-81886804 AGTCCTTTACAAGACATGCAAGG - Intergenic
1100397560 12:94198222-94198244 TGTCCTTTTGGGGATGTGGATGG + Intronic
1101085326 12:101229942-101229964 TTTCCTCTTCAGTAAATGGAAGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103714431 12:122935711-122935733 TCTTTTTTTCAGGACAGGGATGG - Intronic
1103743324 12:123105979-123106001 TGTGCTCTTCAGGACAGGCAGGG - Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105737079 13:23282633-23282655 TGCCCTTCTAGGGACATGGATGG - Intronic
1106486304 13:30175761-30175783 TGTCCTTTTTTGGATATAGATGG - Intergenic
1107177364 13:37414783-37414805 TGTCCTATTCAGGGGAAGGAGGG - Intergenic
1107979526 13:45721221-45721243 TGTGCTGTTCAGGTCTTGGATGG + Intergenic
1108713197 13:53054391-53054413 TGGCCTTTTCAGAACATGCATGG + Intergenic
1109600715 13:64624512-64624534 TATCATTTTCAGGAAATGGGAGG + Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110598149 13:77341422-77341444 AGCCCCTTTCAGGAGATGGAAGG + Intergenic
1110894433 13:80731566-80731588 TGTCTTTTCAGGGACATGGATGG - Intergenic
1111396718 13:87675542-87675564 TGTCCTTGTGAGGAAAAGGACGG + Exonic
1112157150 13:96830755-96830777 TGTTCTTTTCAGAATATTGAGGG + Intronic
1112711891 13:102138667-102138689 TGTCCTGTTCAGGACACTGAGGG - Intronic
1112727168 13:102318078-102318100 TGGCATTTTCAGTAAATGGAGGG + Intronic
1113420454 13:110167319-110167341 TGTGCTTTCCAGAACATTGAGGG - Intronic
1113875284 13:113590395-113590417 TGTCCTTTTACAGACCTGGATGG + Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115175333 14:30555558-30555580 TTTCCTTTTCAGGAAAAGGATGG - Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116242196 14:42359271-42359293 TCTCTTTTTCAGGATAAGGATGG - Intergenic
1116842502 14:49833718-49833740 AGTTCCTTTCAGGTCATGGAGGG - Intronic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118636607 14:67753756-67753778 TTTCCTTTTCAGGTCATGCTGGG - Exonic
1119521733 14:75291329-75291351 TGTTCTGTTCAGAAGATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120328240 14:83055500-83055522 TGTCCTTTTTAGAACATGAATGG - Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1123000468 14:105291283-105291305 TGGGTCTTTCAGGACATGGAGGG - Intronic
1123206541 14:106719138-106719160 TATGCTTTTCAGCACATGGGTGG + Intergenic
1123835501 15:24187097-24187119 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123850270 15:24348448-24348470 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123855212 15:24403009-24403031 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123871239 15:24575943-24575965 TGTCCTTTTAATCACATGGCTGG - Intergenic
1125421302 15:39507312-39507334 TGTTCTTTTCTGGTCCTGGAGGG - Intergenic
1125764068 15:42121364-42121386 TGTCCTTTTCAGGACAGAAGGGG + Intergenic
1125773636 15:42190443-42190465 AGGCCTTTTCTGGACATGCAGGG - Intronic
1126417398 15:48432068-48432090 TTTCCTTTTCTGGACTTGGTTGG + Intronic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1130890650 15:88131224-88131246 TTTACTTTTCAGGGCATGGTGGG - Intronic
1131419519 15:92293013-92293035 TGTCCTTCTGGGGTCATGGATGG + Intergenic
1131797841 15:96038048-96038070 TGTCCATTTCAGAACAGAGAAGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132382862 15:101378835-101378857 AGTCCTTTTCACACCATGGATGG + Intronic
1134388089 16:13793148-13793170 TGTCCTTTCCAGGTCAATGATGG - Intergenic
1134651120 16:15909689-15909711 AGTCCCTTTCAGGGGATGGATGG + Intergenic
1135937109 16:26791011-26791033 TTTCCTTTTCCTGACATGCATGG + Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1138853504 16:60658759-60658781 TGTCTTCTTCACAACATGGATGG - Intergenic
1139466661 16:67157702-67157724 TGGCTTTTTCTGGACAGGGAAGG - Intronic
1139825729 16:69755764-69755786 TGTCTTCTTTAGGACATGAAGGG + Intergenic
1141269075 16:82522560-82522582 AGACCATTTCAGGACATAGATGG + Intergenic
1141419860 16:83906975-83906997 TCTCCTTTTCAGGAAATGAATGG + Exonic
1142261249 16:89043423-89043445 CGTCTTCTTCAGGACAGGGAAGG - Intergenic
1144655508 17:17032680-17032702 TTTCTTTTTCAGGACATGCAGGG - Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1150997430 17:70334797-70334819 AGTCAAATTCAGGACATGGAGGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153028976 18:695947-695969 TGCCCTTCTCAGTGCATGGATGG + Intronic
1153134051 18:1892891-1892913 ATTCTTTTTCAGGACATTGATGG - Intergenic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153590477 18:6669400-6669422 TGGCCATTTCTGGAAATGGAAGG - Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153842481 18:9019275-9019297 TGTCTTTTTGGGAACATGGATGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1155179703 18:23333808-23333830 TGTTCTTTTCTGGAGGTGGAGGG + Intronic
1156668841 18:39442723-39442745 TGTCCCTCTCATGACATGTAGGG - Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157098372 18:44707969-44707991 TGTGCTTCTCAGGACATGCCAGG - Intronic
1157182098 18:45507019-45507041 TGTCCTTTCCTGTACATTGAAGG + Intronic
1158335281 18:56409610-56409632 TGTGTTTTTCAGGACATATATGG + Intergenic
1159277451 18:66239170-66239192 TGTCTTTGTCGGAACATGGATGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160513850 18:79467722-79467744 TTTCCTTTTCAGGGCATCGATGG - Intronic
1161243569 19:3236325-3236347 TGTCCTTTTCAGTGCATGTGTGG + Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1161897181 19:7091180-7091202 TGCCCTTCTCAGGACATAGCTGG - Intergenic
1163494271 19:17636147-17636169 TGTCCATTTCAGGCCAAGAAGGG - Exonic
1165831701 19:38733809-38733831 AGCCCTCTTCAGGGCATGGAGGG - Intronic
1165945797 19:39441461-39441483 TGTCCTTCACAGGACAGGCAAGG - Intronic
925597698 2:5572362-5572384 AGTCCTTTTCTGGACAAGGAAGG + Intergenic
926449040 2:12980045-12980067 TGGCCTTTTCAGGTCAAGAATGG - Intergenic
927408436 2:22798131-22798153 TTTCCTTCTCAGTACAAGGATGG + Intergenic
928427952 2:31194088-31194110 TGGCCTTTTCAGGACAAAAAAGG + Intronic
928471002 2:31575838-31575860 TGTCTTTTTCAAGACTTTGATGG - Intronic
928643217 2:33322363-33322385 AGTCCTTTTTAGATCATGGAAGG + Intronic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
931858734 2:66331588-66331610 TTTCCTTTTCGGTATATGGAAGG - Intergenic
932539765 2:72639538-72639560 TGTCCTTGTTTGCACATGGATGG - Intronic
932583038 2:73004963-73004985 TGCCCTTTCCAGAACATGGCAGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933492294 2:83001372-83001394 TGTCCCTCTCAGGACAGAGATGG - Intergenic
933531297 2:83516131-83516153 TTTCCCTTTCTGAACATGGATGG + Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
937946085 2:127338635-127338657 TGTCCTTTCAGGAACATGGATGG - Intronic
939729169 2:145760349-145760371 TGTACTTTTCAGAACTTTGAAGG - Intergenic
939844629 2:147228433-147228455 TTTCAGTTTAAGGACATGGAGGG + Intergenic
940660930 2:156544280-156544302 TGTCCTTTTAATGACATTGGTGG + Intronic
942705655 2:178769074-178769096 TGTCCTGTATAGTACATGGAAGG - Intronic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
946069737 2:217023694-217023716 TGTTCTATTCAGGCCCTGGAGGG + Intergenic
946083131 2:217143873-217143895 TGTCCTTTTCAAGAAAGTGATGG - Intergenic
946573213 2:221046928-221046950 TGTCCTTTTGAGGACATTTCAGG - Intergenic
946810085 2:223514497-223514519 TGTCCTATTCTGGCCATGTAAGG - Intergenic
946918680 2:224554272-224554294 TCTCGTTTTCAGAAGATGGATGG + Intronic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
947393144 2:229660424-229660446 TGTCCTTGCAGGGACATGGATGG - Intronic
948141476 2:235675467-235675489 TGTCCTTTTCAGGCCAGGCGCGG - Intronic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1170331314 20:15213829-15213851 TGTCCTTCCTAGGACATGGCTGG - Intronic
1170809766 20:19664870-19664892 TGTCCTTTTCATGACACACATGG - Intronic
1170843856 20:19945912-19945934 TGTGCTTATCAGGAAATGGGCGG - Intronic
1172654073 20:36526222-36526244 TCCCCTTTTCTGGACATGCAGGG - Intronic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1174059245 20:47821001-47821023 TTTCCATTTCAGGAGCTGGAGGG + Intergenic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1175002892 20:55649045-55649067 TGTCCTATTAAGGAGTTGGAAGG - Intergenic
1177114400 21:17067793-17067815 TCTTCTTTTCAGGACACCGATGG - Intergenic
1177218562 21:18160637-18160659 TGTCCTTGCAGGGACATGGATGG - Intronic
1178185153 21:30209899-30209921 AGTCCTTCTCAGGACAAGGAAGG + Intergenic
1179114918 21:38482110-38482132 GGTCCCTTCCAGGCCATGGATGG - Intronic
1180217180 21:46332497-46332519 TGTCCTCTTAAGGAAGTGGATGG + Intronic
1182727775 22:32461508-32461530 TCTGCCTCTCAGGACATGGAGGG - Intronic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1185306491 22:50120378-50120400 AGTTCTTCTCAGGAAATGGATGG + Intronic
952303720 3:32126944-32126966 TGTCCCTTTCCTGACATAGAAGG - Intronic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954883833 3:53854816-53854838 TGTCCTTTTCAAATGATGGATGG + Intronic
955524824 3:59809260-59809282 TGTCCTTATAAGGACATCAACGG + Intronic
956330494 3:68101602-68101624 TTTCCTCTTCAAAACATGGAAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960766593 3:121136917-121136939 TGGCCTTTTCAGCACATAGAGGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
962316469 3:134362540-134362562 TGTTCTTTTCAGACCATGGAAGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964048242 3:152357872-152357894 TCAGCTTATCAGGACATGGATGG + Intronic
964672384 3:159240893-159240915 TGTCTTTTTCAGAACACTGACGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968588913 4:1448171-1448193 TGTCCTCTTCAGGGCATAGTGGG + Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
969311820 4:6357312-6357334 GGTCCATTTCAAGACATGGGGGG - Intronic
969694344 4:8726174-8726196 TGTCCTTGTCTGCTCATGGACGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
973066627 4:45802830-45802852 TGTCCCTTCCAGGACATGAGGGG + Intergenic
973123052 4:46546566-46546588 CGTCCTTTTCAGGGAATGAATGG - Intergenic
974986806 4:69037463-69037485 TGTATTTTACAGGACATAGATGG - Intronic
975398816 4:73910098-73910120 TGTCCTTGTAGGGACATGGATGG + Intergenic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
976148374 4:82066793-82066815 TGTCCTATTCAGGTCTTGGGTGG - Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
976988685 4:91335577-91335599 TTCCCTTTTCTGGACATAGAAGG + Intronic
977446782 4:97140690-97140712 TGTTCTATTCAGGCCCTGGATGG + Intergenic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
977898040 4:102385775-102385797 TCTCAATTTCAGGACAAGGAAGG + Intronic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980486323 4:133461792-133461814 TGTCCTTTACAGGCCCTGGGGGG + Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981012346 4:139938327-139938349 TGTCCTTTTCTGTAAACGGATGG - Intronic
982971650 4:161995923-161995945 TGGCCTTTTTAGGACACTGATGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
983499432 4:168482272-168482294 TGCCCTTACCAGGACATTGAAGG + Intronic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
984858625 4:184217546-184217568 TGTCCTCTTCTGGGCAGGGAGGG - Intronic
986036239 5:3942987-3943009 TTTCCTTGTCTGGACATGGCAGG - Intergenic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
986818503 5:11439111-11439133 TGGCCTTTTCAGGAAATGAGAGG - Intronic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993076084 5:83233505-83233527 TGTCCTTTTCTGGAGAAGAATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994057371 5:95433422-95433444 GGTCCTTCTCATGACATGTAGGG + Intronic
994336263 5:98569688-98569710 TGTTCTGTTCAGGACAGGAAAGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994803897 5:104418115-104418137 TGTCCTTGCAAGAACATGGATGG + Intergenic
994971426 5:106744526-106744548 TGTCTTCTATAGGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
995886233 5:116897275-116897297 TGTCCATCTCAGTAAATGGAAGG - Intergenic
995997380 5:118318330-118318352 TGTCCTTTTTAGCATATGTATGG - Intergenic
996475437 5:123914534-123914556 TGTCTTTGCCAGGACATGCATGG + Intergenic
996640510 5:125746261-125746283 TTTCTTTTTCAGGAAATTGAAGG + Intergenic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003076583 6:2988426-2988448 AGTCCTTTCCAGGACACTGAAGG + Intronic
1003586298 6:7392045-7392067 TGTCCTTTTCTGTACATGAGAGG + Intronic
1003740886 6:8937684-8937706 TGTCCTTGCAGGGACATGGATGG - Intergenic
1004622597 6:17344162-17344184 TGTCCTATTAAGAGCATGGAGGG + Intergenic
1004918753 6:20356746-20356768 TGTCTCTCTGAGGACATGGATGG + Intergenic
1005200407 6:23338189-23338211 TGTCCTTTTCTGGATATTAAGGG + Intergenic
1005724727 6:28637561-28637583 TTTCCCTTCCATGACATGGAAGG + Intergenic
1005811469 6:29519398-29519420 TGCCCATTTCAGGACATTTAGGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1007046382 6:38779128-38779150 TTTCCCTTTCAGCACAGGGAGGG + Intronic
1007189012 6:39997756-39997778 TGTCCTTGTCAGGGCTAGGACGG - Intergenic
1007398079 6:41588542-41588564 TCTGCTTTTCAGGCCATGGGTGG + Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008611322 6:53187067-53187089 TGTCCTTTTCAGGCCAGGTGTGG - Intergenic
1009207752 6:60824050-60824072 TGTCATTTTCAGGTCATGTTAGG - Intergenic
1009564239 6:65291597-65291619 TGTTCTTTCCATGACATGAATGG + Intronic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1013192148 6:107812601-107812623 TGTTCTTTTCAGGCCTTCGATGG - Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014143491 6:117970838-117970860 GGTCCCTTTCACGACATGTAGGG + Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1014844555 6:126259126-126259148 TGTCCTTTACAGGAACTAGATGG - Intergenic
1015335626 6:132034529-132034551 TGCCCTTTTAAGGACATTGCAGG + Intergenic
1015917324 6:138230473-138230495 TATTCTTTTCAAGAAATGGAAGG - Intronic
1018140301 6:160826956-160826978 TGTTCTTTCCACGACATGAAAGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022811697 7:33874910-33874932 TGTCCTTTTAAAGACATTGTGGG + Intergenic
1022957074 7:35390811-35390833 TTTGCTTTTGAGAACATGGATGG + Intergenic
1024771140 7:52724526-52724548 TGTATTTTTCAGGACTTGAATGG - Intergenic
1025235669 7:57233032-57233054 TTTCCATTTCAGGAGCTGGAGGG - Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1028725203 7:94078749-94078771 TGTCCTGTTCAAGAGAAGGAGGG - Intergenic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1031562987 7:123260626-123260648 TGTCCTTCTAAGGACAAGGAAGG - Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032389374 7:131546091-131546113 TTTCCTTCTCAGGAAAGGGAGGG - Intronic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034742250 7:153487149-153487171 TGGCCTTTTCAGGATGTGGATGG - Intergenic
1034894473 7:154867251-154867273 TGGCCATTTCAGTACATGAACGG + Intronic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1036502860 8:9329319-9329341 TGACCTATTCAGGAAATGGGAGG + Intergenic
1040846306 8:51845290-51845312 TGTCCTCTTCAGGACATGAGAGG - Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1042306258 8:67336657-67336679 TGTCCTTTTAAGGAAGAGGAAGG - Intronic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043290500 8:78594382-78594404 AGTCCTTTCCAGATCATGGAAGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043920365 8:85975779-85975801 TGTCATTTTCAGAACAGGGCAGG - Intergenic
1044927455 8:97221692-97221714 TGTCCTTTTAAGGACAGGGGAGG + Intergenic
1045961008 8:107968286-107968308 TGTCATTTCCAGTGCATGGATGG + Intronic
1046390781 8:113569543-113569565 TGTCATTTTTAAGACATGGTTGG + Intergenic
1046882769 8:119328346-119328368 TGTGCTTTTCAGGGCAGGGTGGG + Intergenic
1048018345 8:130517227-130517249 TTGCCTTTCCAGGGCATGGAAGG + Intergenic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048290964 8:133181501-133181523 TGGCCTCTTCAGCACATGGATGG + Intergenic
1049086035 8:140479313-140479335 TGTCTTTTCAGGGACATGGATGG + Intergenic
1050419332 9:5446935-5446957 TGTCCTTTCAAGGAAATGGTGGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051612053 9:18970761-18970783 TATGCTTTTTATGACATGGATGG + Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053586536 9:39464469-39464491 TGTCCCTTTCAGGCCCGGGAGGG + Intergenic
1054144748 9:61554180-61554202 TGGCCTTTTGGGGTCATGGAGGG - Intergenic
1054579771 9:66900764-66900786 TGTCCCTTTCAGGCCCGGGAGGG - Exonic
1055593978 9:77846981-77847003 TGTTCCTTTCAGGACAGGGTAGG - Intronic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056739480 9:89241781-89241803 TGCCCTTTTTAGACCATGGAGGG - Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057173434 9:92977183-92977205 TGTGCTCTTCAGGACATGGTGGG + Intronic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058541141 9:106013876-106013898 TGTTCCTTTCTAGACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059010654 9:110455402-110455424 TGTCCTTTTCCGGTTATGTAAGG - Intronic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186082441 X:5947726-5947748 TGTCATTTTCCCGACATGGCTGG + Intronic
1186115694 X:6303181-6303203 TGTCTTTTCAGGGACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1189609893 X:42721051-42721073 TGTCTTTGTAGGGACATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1192458924 X:71300799-71300821 TGTCTTCTTTAGGACATGAAGGG - Exonic
1192699430 X:73452142-73452164 TTTCCTTTTCTGGAGATGAAAGG + Intronic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1197989384 X:132300841-132300863 TGTCCTTTTCAAGATGTGGAAGG - Intergenic
1198272207 X:135065606-135065628 TGTCCTTTTTAGAACATGGTTGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199878097 X:151950956-151950978 TGTCATTCTCAGGCCATGGCTGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic