ID: 1153477878

View in Genome Browser
Species Human (GRCh38)
Location 18:5517210-5517232
Sequence CTGAGAGTCTGACAGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153477878 Original CRISPR CTGAGAGTCTGACAGGGTGA GGG Intronic
900054015 1:615790-615812 CTAAGAGTAGGACAGGGTGTGGG + Intergenic
900806153 1:4769583-4769605 CTTGGAGACTGACAGGGTGGTGG + Intronic
901387668 1:8921674-8921696 CTGAGAGGCTCCCATGGTGAAGG - Intergenic
901643537 1:10704974-10704996 CTAAGAGGCTGGCAGGGAGAAGG - Intronic
902899920 1:19507766-19507788 CTTAGAGGCTGGCAGGCTGAGGG - Intergenic
902946609 1:19845219-19845241 GTGAGAGGATGAGAGGGTGAGGG + Intergenic
903295775 1:22342316-22342338 GGGAGAGACAGACAGGGTGACGG + Intergenic
903308655 1:22434103-22434125 CTGGAAGTCTGACAATGTGATGG - Intergenic
903562456 1:24238119-24238141 CTGAGGCTCAGACAGGCTGAAGG - Intergenic
903866671 1:26403871-26403893 TTTAGAGGCTGTCAGGGTGAGGG + Intergenic
904304764 1:29580964-29580986 CTGAGACTCTGAGAGGGGGCAGG - Intergenic
905629373 1:39510354-39510376 CGGAGGGTCTCACTGGGTGATGG - Intronic
905668385 1:39775839-39775861 CGGAGGGTCTCACTGGGTGATGG + Intronic
907264575 1:53249549-53249571 CTGATTGCCTGACAGGGGGATGG + Exonic
908806665 1:67939192-67939214 CTGAGAGTAGCACAGGGTCATGG - Intergenic
909272059 1:73635340-73635362 CTGATAGTTTGGCAGAGTGATGG + Intergenic
912219362 1:107654795-107654817 CTTAGAGTCTAACAGGGAAAAGG + Intronic
912219840 1:107660787-107660809 CTTAGAGTCTAACAGGGAAAAGG + Intronic
912528080 1:110299630-110299652 CTGAGAGGCTGACAGACTAAGGG - Intergenic
912955256 1:114151260-114151282 CTGAGAGGCTGAAAGGGATATGG - Intronic
913601832 1:120428727-120428749 CACAGAGACTGACAGGCTGAGGG - Intergenic
916740576 1:167643949-167643971 CTGAGAGTTTGACAGAGGGGTGG + Intronic
920690031 1:208139253-208139275 CTGAGACTCTGAGAAGTTGAGGG + Intronic
922255536 1:223890051-223890073 CTAAGAGTAGGACAGGGTGTGGG + Intergenic
922439268 1:225639013-225639035 TTGAGAGACTGACAGGGCAAAGG - Intronic
924023407 1:239808978-239809000 CCCAGACTTTGACAGGGTGAGGG - Intronic
924024438 1:239817811-239817833 CTGAGAGGGTGAGAGGGTGGTGG - Intronic
924211266 1:241769753-241769775 CTGTGAGGCTGACATGGTGAGGG - Intronic
924268381 1:242306000-242306022 CTGAGAGTCTGCCTGGGTCCAGG - Intronic
924336738 1:242992920-242992942 CTAAGAGTAGGACAGGGTGTGGG + Intergenic
1064990813 10:21255159-21255181 CTGAGAGTTTAAGAGGGCGATGG + Intergenic
1065790352 10:29254713-29254735 GTCAGAGTCTGTCTGGGTGACGG - Intergenic
1067909803 10:50334854-50334876 GTGAGAGTCTCACTGGGGGAAGG + Intronic
1069834197 10:71298300-71298322 CTGAGAGTCTGCCTGGCTCAAGG - Intronic
1070446487 10:76509695-76509717 CTGAGAGGCTGTCTGTGTGAAGG + Intronic
1070957611 10:80474516-80474538 CTGAGTGTCTGGGTGGGTGAAGG + Intronic
1071264430 10:83952042-83952064 CTGAGGCTCTGACAGGTTAAAGG + Intergenic
1071452265 10:85808276-85808298 ATGAGAGTCTCACTAGGTGAAGG + Intronic
1072546699 10:96445578-96445600 CTGAGAGAATGAATGGGTGAGGG - Intronic
1072977782 10:100074281-100074303 CTGAGAGTCTGAGAACCTGATGG + Intronic
1073403434 10:103277046-103277068 CTCAGAGTCTGGCCGGGAGAGGG - Intergenic
1073763606 10:106657443-106657465 TGGAGAGTCAGAAAGGGTGAGGG + Intronic
1076064115 10:127435291-127435313 CTGTGGGTTTGATAGGGTGATGG - Intronic
1077168568 11:1154494-1154516 CTGAGCGGCTGACAGGGTTAGGG - Intergenic
1077635574 11:3839777-3839799 CAGAGAGGGTGACAGGCTGAGGG + Intronic
1078064763 11:8071196-8071218 CTGGGTGTGTGACTGGGTGAGGG + Intronic
1078553829 11:12301640-12301662 CTGAGTGTTTTACAGGGAGAAGG + Intronic
1079118034 11:17653086-17653108 ATGAGAGTCTGGCAAAGTGATGG + Intergenic
1081650933 11:44823821-44823843 CTGATTGTCTCAGAGGGTGATGG - Intronic
1083473799 11:62902432-62902454 CTGAGAGCCTGACGTGGTGCTGG + Intergenic
1084207032 11:67601199-67601221 CTGAGACCCTGGCAGAGTGATGG + Intergenic
1084536549 11:69760798-69760820 CTGTGAGTGTGTCAGGGGGAGGG + Intergenic
1084846372 11:71903664-71903686 CTGAGAGTCTAAAAGACTGAGGG - Intronic
1085887373 11:80536328-80536350 CTGAAAGGCTGGCAGTGTGAGGG - Intergenic
1089722827 11:120444914-120444936 CTGGGAGTGTGACATTGTGAGGG + Intronic
1090642235 11:128739576-128739598 CTGAGAGTGGGACAGTGGGAGGG + Intronic
1090952593 11:131486700-131486722 GTGACAGGCTGCCAGGGTGATGG - Intronic
1091857966 12:3754107-3754129 CTGAAACTCTGGCAGGGTGGAGG - Intronic
1092134648 12:6138200-6138222 CTGAGGCTCAGACAGGGTAAGGG + Intergenic
1093088960 12:14900247-14900269 GAGAGAGTCTTACAGGCTGAAGG + Intronic
1093231120 12:16543141-16543163 CTGAGAATCTGACATGCAGAAGG + Intronic
1097156270 12:57014502-57014524 TTGAGAGTCTGTGAGGATGAGGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1097827061 12:64185063-64185085 CTAGAAGTCTGACATGGTGATGG - Intergenic
1099423994 12:82500607-82500629 CTGAGAGATTGACAGGGTTGTGG + Intergenic
1099470547 12:83042649-83042671 ATGACTGTCTGACAGGGTGTGGG - Intronic
1101022920 12:100572255-100572277 CTAAGAGTCTTGAAGGGTGATGG - Intergenic
1101324762 12:103705962-103705984 CTGAGAGTCCGAGAGGCTAATGG + Intronic
1101490907 12:105208443-105208465 CTGAGGGTCTGTGAGGGAGAGGG + Intronic
1101536537 12:105623059-105623081 CAGAGAGACTGACAGGGTTGAGG - Intergenic
1103092103 12:118104522-118104544 CTGGGAATCTGACTGGGTAAGGG - Intronic
1103666238 12:122568453-122568475 GTGCAAGTCTGACTGGGTGATGG + Intronic
1106381142 13:29240533-29240555 CTGTGATTCACACAGGGTGAAGG - Intronic
1106482688 13:30148616-30148638 CTGAGATGCTGTCAGGGTGGAGG + Intergenic
1106618782 13:31354464-31354486 CTGTCAGTCTAATAGGGTGATGG + Intergenic
1110379382 13:74832919-74832941 CTCAGAGTCTGCCAGTGTCAGGG + Intergenic
1111204105 13:84981523-84981545 CTTAGAGTGTGACATGGTTAAGG - Intergenic
1112015484 13:95327965-95327987 CTGAGAGTCTGGGAGGATTAAGG - Intergenic
1112799865 13:103098706-103098728 CTGAGCGTTTCACAGGATGAAGG + Intergenic
1113812817 13:113152888-113152910 CTGAGAGACAGACAGGGAGAGGG + Intergenic
1114238991 14:20848763-20848785 CTGAGAGTCACACTGGGGGAAGG + Intergenic
1119182419 14:72613970-72613992 CTGAGAGTGGGGCAGGGGGAAGG - Intergenic
1119865415 14:77969300-77969322 CAGAGAGTCTCATGGGGTGAAGG - Intergenic
1120037824 14:79717942-79717964 CTCAGAGTCTACAAGGGTGATGG - Intronic
1120739961 14:88097098-88097120 CTGGTAATCTGACAGGGAGATGG - Intergenic
1121642598 14:95495798-95495820 CTGAGAGACAGACGGGGTGGAGG + Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1125588619 15:40840221-40840243 CTGAGGGTCTGAACAGGTGAGGG + Intergenic
1126335510 15:47582763-47582785 TTGAGAGGCTGGCAGGCTGAGGG - Intronic
1128234268 15:66056837-66056859 ATCAGAGAATGACAGGGTGAAGG - Intronic
1129118198 15:73378119-73378141 CAGAGACTCTGACAGGGACAGGG + Intergenic
1129359546 15:75016129-75016151 CTGTGAGTCTGGGAGGGTCAGGG + Intronic
1129716142 15:77852180-77852202 CTAAGACTGTGACAGTGTGAAGG - Intergenic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1130371985 15:83292778-83292800 CTGAGATTCTGACAGAGGGTTGG + Intergenic
1131392634 15:92061786-92061808 AGGAGCGTCTAACAGGGTGATGG - Intronic
1131989913 15:98083184-98083206 CTGAGAGTCTGAGAGTGTAGTGG - Intergenic
1132180517 15:99749424-99749446 CTTAGAGTGTGCCAGGGTGCGGG - Intergenic
1133386638 16:5375449-5375471 CTGAGAGTCTGGGATAGTGACGG + Intergenic
1135487610 16:22879703-22879725 CAGAGAGGCTGACAGACTGATGG - Intronic
1135760790 16:25136560-25136582 GTGAGACTCTGACGGGTTGATGG - Intronic
1135930032 16:26728476-26728498 CTGAGGGTCTGACCGGATGATGG - Intergenic
1136057377 16:27700528-27700550 GTGAGAGAATGACAGGGTGTGGG + Intronic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1137594274 16:49713548-49713570 CTGAGAACCTGCCAGGGTGCGGG - Intronic
1139212011 16:65087412-65087434 CTGAGAGTCTGACCATGGGAAGG + Intronic
1139224726 16:65223109-65223131 CTGAGAGTCAGAGAGGGAAATGG + Intergenic
1139243869 16:65421558-65421580 CTGGGAGTCTCACAAGGTTATGG + Intergenic
1139272757 16:65699071-65699093 CCCAGAGTCAGGCAGGGTGATGG + Intergenic
1139597582 16:67967446-67967468 CTGTGGGTATCACAGGGTGAAGG - Intronic
1140330462 16:74051947-74051969 TTGAGATTCTCACAGTGTGATGG - Intergenic
1141197378 16:81870313-81870335 CTGAGGGTTTGAAAGGGTCAAGG + Intronic
1142172596 16:88630702-88630724 CTGCTGGTCTGACGGGGTGAGGG + Intronic
1142638865 17:1273527-1273549 CTGAGAGTGTGATAGGATGGGGG - Intergenic
1143446279 17:7012107-7012129 TTGAGATTCTGACAGTGTAAAGG - Intronic
1144496612 17:15749832-15749854 CTGAGGGGCTGAAAGGCTGAGGG + Intergenic
1144606263 17:16667477-16667499 CTGAGGGGCTGAAAGGCTGAAGG + Intergenic
1145103470 17:20095897-20095919 CAGAGGCTCTGAGAGGGTGAGGG + Intronic
1148237233 17:45976953-45976975 CTGAGTTTCTGACAAGGTGATGG - Intronic
1148321316 17:46756150-46756172 CTGAGAGTTTTCAAGGGTGATGG - Exonic
1150315156 17:64163004-64163026 CTGAGCCTCTGCCTGGGTGAGGG + Intronic
1152150167 17:78594380-78594402 CTAAGAGTCTGACACGTTTAAGG + Intergenic
1152486154 17:80594980-80595002 CTGAGAGTCAGAGAGAGAGAGGG + Intronic
1153477878 18:5517210-5517232 CTGAGAGTCTGACAGGGTGAGGG + Intronic
1153772848 18:8429302-8429324 CTGAGTGTCCCACAGAGTGAGGG + Intergenic
1154073426 18:11176633-11176655 CTGAGAGCCTTACAGAGGGAGGG - Intergenic
1154202990 18:12312349-12312371 CTGAGAGGCAGACAGTGTAATGG + Intronic
1155097971 18:22578161-22578183 TTGGGAGTGTGACTGGGTGAGGG - Intergenic
1155722979 18:29042065-29042087 CTGAGAGTCTGGCAAGGACAAGG + Intergenic
1157145461 18:45158068-45158090 CTCAAAGTCTGAAAGGGGGAGGG - Intergenic
1158388454 18:57021386-57021408 CTGTGACTCTAACAGGGTGTAGG + Intronic
1160444439 18:78915897-78915919 CTCAGAGGCAGCCAGGGTGAGGG + Intergenic
1160928557 19:1558840-1558862 CTGGGGGTCTGACCTGGTGAGGG + Intronic
1161257137 19:3315626-3315648 CTGAGAGGCGGACAGTGTGACGG - Intergenic
1161843506 19:6696546-6696568 CTGAGGGGCTGGCAGGGTAAGGG - Intronic
1166801413 19:45459933-45459955 CTGAGAGTCTGTCAGAGTTTAGG + Intronic
1167421564 19:49407063-49407085 CTGGGAGCCTGACAGCTTGATGG - Intronic
1167855904 19:52239670-52239692 GTGAGAGTTTGACATGGAGAGGG + Intergenic
1168145116 19:54416160-54416182 TTGAGAGTCTGAAATGGGGAAGG + Intronic
925618664 2:5768818-5768840 CAGAGAGTCTGAGAGGTTGGGGG + Intergenic
925906999 2:8545581-8545603 CTGAGAGGCTGACAGGGTGGTGG - Intergenic
927144925 2:20157295-20157317 CTGAGAGGTTGGCAGGGTGAGGG + Intergenic
927321603 2:21753531-21753553 CTGAAAGTCTCACAAAGTGATGG - Intergenic
927826630 2:26313875-26313897 CTGAGAGCCTGACTCGTTGAAGG + Exonic
929457235 2:42074663-42074685 TTGTGAGACTGAGAGGGTGAAGG - Intergenic
929853462 2:45614270-45614292 CTGAGAGTCAATCAGTGTGATGG + Intergenic
932638974 2:73422676-73422698 TTGAGAGTCTGACAAGGTCCAGG - Intronic
932665757 2:73697607-73697629 TTGAGAGTCTGACAAAGAGAGGG + Intergenic
932965572 2:76471187-76471209 ATGAGAGTCTCATAGGGAGATGG - Intergenic
933713678 2:85345154-85345176 CTGAGAGTCTGAGAGAGGGGAGG + Intronic
936906239 2:117538034-117538056 CTGAGAGTCAGACATGGCCATGG - Intergenic
938263355 2:129910364-129910386 CAGAGATTATGACATGGTGATGG - Intergenic
939805429 2:146770066-146770088 AGGAGAGTTTGAGAGGGTGATGG - Intergenic
944439475 2:199727522-199727544 CTGGGAGCCTCACAGGGTAAGGG - Intergenic
944502048 2:200371996-200372018 CTGGGAGTCTGAGATGGTGATGG - Intronic
945135873 2:206627101-206627123 CTGGAAGGCAGACAGGGTGATGG - Intergenic
945918752 2:215732714-215732736 CTGAGAGTTTGACACCGTTAAGG - Intergenic
946190854 2:218007213-218007235 CTGAGGGGCTGAGAGGGTGGAGG - Intergenic
946207958 2:218124441-218124463 CTGAGGTTTTGTCAGGGTGAAGG + Intergenic
1168882204 20:1216732-1216754 CTGAGTGATTGACAAGGTGAAGG - Intergenic
1169122925 20:3108034-3108056 CTGAGACCATGACAGGGTGAAGG + Exonic
1172077399 20:32309795-32309817 CTCAGAGTCAGTCAGGGTGGTGG + Exonic
1172590336 20:36113198-36113220 CTGTGATTCTGGCAGGGCGAGGG + Intronic
1176371043 21:6061545-6061567 CTGAGACTGGGACAGGGGGACGG - Intergenic
1178596584 21:33959313-33959335 AAGAGAGTCTTACAGGCTGAAGG + Intergenic
1179380464 21:40894606-40894628 CTGAGCATCTGCCATGGTGAAGG - Intergenic
1179752476 21:43476996-43477018 CTGAGACTGGGACAGGGGGACGG + Intergenic
1179911076 21:44449181-44449203 CTGAGAGAATGAGAGGGTGCAGG + Intergenic
1180070983 21:45435696-45435718 CTGGGAGTCCTATAGGGTGAAGG + Intronic
1180755583 22:18158691-18158713 CTGAGAGGCTGAAAGGCAGAAGG - Intronic
1181014358 22:20060757-20060779 CTGGAAGTCTGACAGGGAGAGGG + Intronic
1182074169 22:27483771-27483793 TCGAGAGCCTGAAAGGGTGAGGG + Intergenic
1182317439 22:29457373-29457395 CTGAGAAGCCTACAGGGTGAGGG - Intergenic
1182627270 22:31656704-31656726 CTGAGAGGCTGACAAGATGTGGG - Intronic
1183475834 22:38035306-38035328 CTGAGAATCAGGCAAGGTGAGGG - Intronic
1184436159 22:44478604-44478626 TTGACAGCCTCACAGGGTGACGG - Intergenic
1185343532 22:50301785-50301807 CTGAGGCGCTGACAGGCTGACGG - Intronic
952333571 3:32386127-32386149 CTGAGAGTTTGACTGGTTTACGG + Intergenic
953736372 3:45497547-45497569 TTGAAATTCTGGCAGGGTGAGGG - Intronic
953909633 3:46885103-46885125 CTGAGGGGTAGACAGGGTGATGG + Intronic
954501770 3:51024503-51024525 CTGAGATTTTATCAGGGTGAAGG + Intronic
955001923 3:54935130-54935152 CTGAGAGTTAGACAGTGTCAGGG - Intronic
955067169 3:55543599-55543621 AAGAGAGACTTACAGGGTGAAGG - Intronic
961062139 3:123838168-123838190 CTTAAAGGCAGACAGGGTGAGGG + Intronic
961638010 3:128345398-128345420 CTGAGAGTCTGGTAGGCTCATGG + Intronic
962420909 3:135228713-135228735 CTGAGAGTCGGGCAGTCTGAGGG + Intronic
962973714 3:140428008-140428030 CTTGGAGGCTGTCAGGGTGAGGG + Intronic
963233056 3:142928452-142928474 TTCAGAGTCTCACAGTGTGAGGG - Intergenic
964055413 3:152450411-152450433 CTGACTGTCTGACAAAGTGATGG - Intronic
964137090 3:153356221-153356243 CTGCCAGTCTTACAGAGTGATGG + Intergenic
964528636 3:157643410-157643432 CTGAGAGGCTCACTGGGTGCTGG - Intronic
964849735 3:161082115-161082137 CTCAGTGTCTGAAAGGGAGAGGG - Intergenic
968428000 4:535793-535815 CTGAGAGGATGACCTGGTGAAGG - Intronic
968788542 4:2642670-2642692 CCCACAGTCTGACAGGCTGACGG - Intronic
969136225 4:5031303-5031325 CCCAGAGTCCGACAGTGTGATGG - Intergenic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969640385 4:8394898-8394920 TTGAGAGCGTGTCAGGGTGAAGG - Intronic
969819549 4:9709728-9709750 CTGAGACTGTGACGGGGTGGGGG + Intergenic
970487281 4:16537229-16537251 GGGAGAGTTTGACAGGGAGAAGG + Intronic
970669060 4:18375190-18375212 CTGGGAGTCTCATATGGTGAGGG - Intergenic
972602133 4:40582047-40582069 CTCAGTGACTGACTGGGTGAAGG - Intronic
972625607 4:40796026-40796048 CTGTGAGTCTTAGAGGGTAAGGG - Intronic
974304619 4:60117638-60117660 CTGAAATTCTTACAAGGTGATGG - Intergenic
975701681 4:77073694-77073716 CAGAGAGTCTTACAGACTGATGG - Intronic
975759321 4:77603481-77603503 CTGTGAGTCAGAGAGTGTGATGG + Intronic
976189903 4:82477813-82477835 CTGGGGCTCTGAGAGGGTGATGG - Intergenic
977153585 4:93545086-93545108 CTCAGGGTCTGACAAGGAGAAGG - Intronic
978157460 4:105506126-105506148 TTGGGAGACTGACAGGATGAAGG - Intergenic
979240391 4:118442390-118442412 CTAAGAGTAGGACAGGGTGTGGG - Intergenic
979502924 4:121460834-121460856 CTGAGAGAGAGACAGGGGGAAGG + Intergenic
980327919 4:131372192-131372214 CAGAGATTCTAACAGAGTGAAGG - Intergenic
981144305 4:141307289-141307311 CAGATACTCTGACAAGGTGATGG + Intergenic
982197140 4:152927995-152928017 CTGAGAGACTTGCAGGATGAGGG - Intergenic
982899949 4:160986085-160986107 CTGAGAGTCTGACTGGGGGAAGG - Intergenic
984501707 4:180566114-180566136 GTGAGAGTGTGAGAGTGTGAGGG + Intergenic
984541834 4:181048216-181048238 ATGAGAGTCTGAAAGGTTCAGGG - Intergenic
984559147 4:181248009-181248031 CTGAGAACCTAACAGGGTGTTGG + Intergenic
985991957 5:3569685-3569707 CCGGGAGTGTGACAGGGTGGAGG - Intergenic
986173284 5:5331166-5331188 ATGAGTGTGTGACAGGGTGCTGG - Intergenic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
986875246 5:12099426-12099448 GTGAGAGTGTGAAAGTGTGAGGG - Intergenic
987339556 5:16927684-16927706 CAGGGAGTCGGACTGGGTGAAGG + Intronic
988495691 5:31743744-31743766 CTGAGAATCTGACAGAGAGTGGG - Intronic
989547467 5:42691162-42691184 CTGAAAGTGTGACTGGGTAAAGG + Intronic
991958525 5:72019319-72019341 GTGAGAGGGTGGCAGGGTGAGGG - Intergenic
993711881 5:91233337-91233359 CTGAGAGTCAGTCACTGTGAGGG + Intergenic
995401708 5:111749674-111749696 CTGTGAGGCTGACTGGGTGCTGG - Intronic
997212761 5:132087091-132087113 CTTAGACTCTGTCAGGCTGAAGG + Intergenic
997212776 5:132087165-132087187 CTTAGACTCTGTCAGGCTGAAGG + Intergenic
997256953 5:132436217-132436239 CTGAGGGCCTGACAGTTTGAAGG - Intronic
997424266 5:133792573-133792595 GTGACAGTCAGACAGAGTGACGG - Intergenic
997653816 5:135540861-135540883 CTGAGACACTGACAGGGTAGAGG - Intergenic
1001546326 5:172572732-172572754 CATAGATTCTGCCAGGGTGAGGG + Intergenic
1001562374 5:172677973-172677995 CTCAGGGTCTGACAGGCTGAAGG - Intronic
1001915785 5:175558824-175558846 CTGATAGTCTTAAAGGGGGATGG + Intergenic
1002261908 5:177999105-177999127 GTGAGAGTATGGCAGAGTGAAGG - Intergenic
1002261916 5:177999165-177999187 GTGAGAGTATGGCAGAGTGAAGG - Intergenic
1002261924 5:177999225-177999247 GTGAGAGTATGGCAGAGTGAAGG - Intergenic
1002261932 5:177999285-177999307 GTGAGAGTATGGCAGAGTGAAGG - Intergenic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002906459 6:1453106-1453128 ATGAGAGTCTGACACGGTGAAGG + Intergenic
1003343419 6:5243228-5243250 CTGACTGTCTGACTCGGTGACGG - Intronic
1003704199 6:8506239-8506261 CTTAGAGTCTTAGAGGGGGATGG + Intergenic
1005840389 6:29741387-29741409 ATGAGAGTGTGACAGGGTGAGGG + Intergenic
1005854690 6:29852018-29852040 AGGAGAGTGTGACAGGGCGAGGG + Intergenic
1006632778 6:35441407-35441429 CTGAGGGTCTGCCAGAGTGTGGG - Intergenic
1006845715 6:37060001-37060023 GTGTGAGCCTGACAGGGTGGGGG - Intergenic
1008146862 6:47902314-47902336 CTTACAGTCTCACTGGGTGAAGG + Intronic
1009370791 6:62899304-62899326 CTGAGACTCAGACAGGTTAAGGG - Intergenic
1011828692 6:91341985-91342007 CAGAGAATCTTAAAGGGTGAAGG - Intergenic
1012872144 6:104685042-104685064 CGGACCCTCTGACAGGGTGAGGG - Intergenic
1013289630 6:108708954-108708976 CTGATGGTCTGCCAGGATGAGGG + Intergenic
1013474909 6:110498104-110498126 CTGAGTATCTGACAGGATGGTGG + Intergenic
1014176257 6:118334904-118334926 CTGAGAGTATGACTGGGAAAAGG + Intergenic
1017593617 6:156004791-156004813 TTGAGTGTGTGACAGGATGAGGG - Intergenic
1017681264 6:156866273-156866295 CTGGGCATCTGCCAGGGTGAAGG + Intronic
1019245754 6:170708564-170708586 CTAAGAGTAGGACAGGGTGTGGG - Intergenic
1019701338 7:2476228-2476250 CTGAGAGGGCGTCAGGGTGAAGG - Intronic
1019865873 7:3709486-3709508 CTGTGAGTATGACAGTGGGACGG - Intronic
1021790849 7:24204036-24204058 CTGAGACTCTGAGAGACTGATGG + Intergenic
1022516244 7:30976633-30976655 CTGAGTTCATGACAGGGTGAGGG + Intronic
1023618956 7:42049989-42050011 ATTATATTCTGACAGGGTGATGG - Intronic
1023965612 7:44961881-44961903 CTGAGGGGCTGAGAGGCTGAAGG + Intergenic
1024035175 7:45501886-45501908 CTGAGAGTCTGACACATTTAAGG + Intergenic
1025028491 7:55537008-55537030 CTGAGAGGCTGAGAGGATTAAGG + Intronic
1025060059 7:55798188-55798210 CTGAGTGTCTGGCAGGTTGCTGG - Intronic
1028223727 7:88225588-88225610 CTGAGACTCTGACTTGCTGAAGG + Intronic
1031273608 7:119688366-119688388 CCGTGAGTCCCACAGGGTGATGG + Intergenic
1032651142 7:133879896-133879918 CTGAAAGACAGACAGGCTGAGGG - Intronic
1032855161 7:135828093-135828115 CTGAGTGTCTGCCAGGGTCTGGG + Intergenic
1034752718 7:153586056-153586078 CTGGGAGTGTAACATGGTGAAGG + Intergenic
1035502370 8:99634-99656 CTAAGAGTAGGACAGGGTGTGGG + Intergenic
1036080582 8:5551010-5551032 CAGAGAGACAGACAGGGAGATGG - Intergenic
1036754132 8:11461260-11461282 CTGAGAATCTGACAGTTTGGAGG + Intronic
1037037797 8:14189527-14189549 CTGAGAACATGTCAGGGTGAAGG - Intronic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1037261937 8:17019375-17019397 CTGAGAGGCTGCCAGGTTAAAGG - Intergenic
1038474101 8:27850879-27850901 ATGAGAGGCTGAGAGGGTGGGGG - Intergenic
1040543380 8:48379365-48379387 GTGAGAATGTGACAGGCTGAGGG + Intergenic
1041111937 8:54491274-54491296 CAGAGAGTCTGTCATGGTCATGG + Intergenic
1042441567 8:68832991-68833013 CTGAGAGTCTAGCAAGGTCAAGG + Intergenic
1044570642 8:93714427-93714449 CTGGGAGTCTGCTAGGGTTATGG - Intronic
1044728045 8:95208743-95208765 TTGAAAGTCAGACATGGTGAAGG + Intergenic
1044783002 8:95762883-95762905 CTGAGTGACTGACAGGGTTGTGG + Intergenic
1046788280 8:118291885-118291907 CTGAGTGCCTAACAGGGTGTTGG - Intronic
1048092897 8:131260437-131260459 CTGAGAGTTTTGCAGGCTGAAGG + Intergenic
1049017975 8:139934836-139934858 CTGAGAGTCTGAGTGGCTGCAGG - Intronic
1050165119 9:2757475-2757497 CTGAGAGTCTGACACCTTAAAGG + Intronic
1052394504 9:27922514-27922536 CTGGGAGTAGGACAAGGTGATGG + Intergenic
1052853109 9:33390136-33390158 CGAAGGGGCTGACAGGGTGAAGG + Intronic
1056786263 9:89594712-89594734 CTGAGAGCCTGACACAGTGCTGG + Intergenic
1057195234 9:93112739-93112761 CTGGGAGGCTTACTGGGTGAGGG + Intronic
1058146857 9:101421955-101421977 ATGAGAGGCAGACAGGGTCAAGG - Intronic
1058186718 9:101864002-101864024 CTGAGAGTAACATAGGGTGAAGG + Intergenic
1059348655 9:113649224-113649246 CTGAGAGCCTGAGAGGCTGTGGG + Intergenic
1060518159 9:124278750-124278772 CTGAGACTCAGAGAGGCTGAGGG + Intronic
1061193360 9:129094759-129094781 CTGAGAGGCAGGCAGGGTGGGGG - Intergenic
1061394809 9:130338059-130338081 CTGAGAGACAGGCAGGGTGATGG - Intronic
1061579252 9:131526858-131526880 CTGATAGTCTGACGGGCTGGAGG + Intronic
1062088817 9:134663343-134663365 CTGATAGCCTAAGAGGGTGAAGG + Intronic
1062326154 9:136013484-136013506 CTGAGAAGATGACCGGGTGATGG + Intronic
1203605952 Un_KI270748v1:57775-57797 CTAAGAGTAGGACAGGGTGTGGG - Intergenic
1186816593 X:13243875-13243897 CTGAGAGTCTGACAGCTTTGGGG - Intergenic
1192698285 X:73442239-73442261 CTAACAGTCTGAGAGGATGAAGG - Intergenic
1193107591 X:77694884-77694906 CTGAGTCTCTGAAAGGGTGGGGG + Intronic
1194901635 X:99519664-99519686 CCCAGAGTATGACAGGGAGAGGG + Intergenic
1195256717 X:103097903-103097925 CTGAGAGTCTGACACCTTAAAGG + Intergenic
1195308867 X:103610571-103610593 TTAAGTGTCTGACAGGGTGCTGG - Intronic
1196661766 X:118278125-118278147 CTGAACTTCTCACAGGGTGATGG + Intergenic
1197493753 X:127152693-127152715 CTGAGATTTTCTCAGGGTGAAGG + Intergenic
1198040818 X:132850393-132850415 CAGAGAGTCAGAAAGAGTGAAGG + Intronic
1199617913 X:149672276-149672298 ATGAGAGCCTGACAGCCTGAAGG - Intergenic
1199624729 X:149730973-149730995 ATGAGAGCCTGACAGCCTGAAGG + Intergenic
1199686399 X:150269204-150269226 TAGAGAGGCTGGCAGGGTGAGGG + Intergenic
1202388119 Y:24344212-24344234 CTAAGAGTAGGACAGGGTGTGGG - Intergenic
1202482668 Y:25325916-25325938 CTAAGAGTAGGACAGGGTGTGGG + Intergenic