ID: 1153480653

View in Genome Browser
Species Human (GRCh38)
Location 18:5543576-5543598
Sequence CCTGGGATCCCTGGCCGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153480653_1153480672 8 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480672 18:5543607-5543629 CAGGCCGGAGGCCGGGGCTCAGG 0: 1
1: 1
2: 7
3: 55
4: 622
1153480653_1153480664 -4 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480664 18:5543595-5543617 CAGGGAGGCCCCCAGGCCGGAGG 0: 1
1: 0
2: 3
3: 54
4: 450
1153480653_1153480665 0 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480665 18:5543599-5543621 GAGGCCCCCAGGCCGGAGGCCGG 0: 1
1: 0
2: 3
3: 42
4: 411
1153480653_1153480675 21 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480675 18:5543620-5543642 GGGGCTCAGGCTCTGCGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 265
1153480653_1153480667 2 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480667 18:5543601-5543623 GGCCCCCAGGCCGGAGGCCGGGG 0: 1
1: 0
2: 3
3: 40
4: 518
1153480653_1153480661 -7 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480661 18:5543592-5543614 TCCCAGGGAGGCCCCCAGGCCGG 0: 1
1: 0
2: 0
3: 73
4: 486
1153480653_1153480666 1 Left 1153480653 18:5543576-5543598 CCCCTTCGGCCAGGGATCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1153480666 18:5543600-5543622 AGGCCCCCAGGCCGGAGGCCGGG 0: 1
1: 0
2: 2
3: 36
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153480653 Original CRISPR CCTGGGATCCCTGGCCGAAG GGG (reversed) Intronic
900309006 1:2024545-2024567 CCTGGGGTCCCTCACCAAAGAGG - Intronic
900570261 1:3354863-3354885 CCTGTGTTCCCAGGCAGAAGAGG + Intronic
900633560 1:3651313-3651335 ACTGGGTTCTCTGGCCGCAGCGG - Intronic
901208153 1:7509037-7509059 CCTGGGCTCCCTGGCTGCTGTGG + Intronic
901639688 1:10686961-10686983 CTTGGGTTCCCAGGCTGAAGGGG + Intronic
902677113 1:18016401-18016423 CCAGGGTTCCCTGGCCCCAGAGG + Intergenic
904276134 1:29385510-29385532 TCTGGGGTCCCTGGGCCAAGAGG - Intergenic
904584758 1:31574036-31574058 ACTGGGTTCCTTGGCCGAGGAGG - Intergenic
904864087 1:33562801-33562823 CCTGCTATCCCTGGAAGAAGAGG + Intronic
905208061 1:36354229-36354251 CCTGGGATTCCTGGAGGAAGTGG + Intronic
905797942 1:40826013-40826035 CCTGGGGTCCCTGGGAGAAAGGG - Intronic
906492377 1:46278618-46278640 CCTGGGAACCCTGGGCCAGGAGG - Exonic
912431750 1:109631680-109631702 CCTGGGCTTCCTGGCCTGAGTGG + Exonic
914437180 1:147670415-147670437 CCTGAGTTCCCTGGCGGCAGCGG + Exonic
914756420 1:150564091-150564113 CCTGGGATCCCTAGGCTAAAAGG + Intergenic
919097955 1:193059632-193059654 CCTGGAATCCCCGGCGGCAGTGG + Intronic
920293823 1:204943659-204943681 CCTTTGATCCCAGGACGAAGGGG - Intronic
1065552576 10:26884011-26884033 CCTGGGACCCCTGGCTGCAGTGG + Intergenic
1069590160 10:69636369-69636391 CCTGGGATCCCTGGCTGGGGCGG + Intergenic
1071514689 10:86289465-86289487 CCTGGGTTCCCTGGAAGCAGAGG - Intronic
1072720658 10:97778908-97778930 GCTGGGAACCCAGGCAGAAGAGG - Intergenic
1073509710 10:104035313-104035335 CCTGGGATCCCTGGTGGACCCGG + Exonic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1076395654 10:130136131-130136153 TCGGGGCTCCCTGGCTGAAGGGG - Intergenic
1082882787 11:58054673-58054695 CCTGTGATCCCAGGCCGAGGTGG + Intronic
1083590280 11:63889580-63889602 TCTGAGATCCCAGGCGGAAGGGG + Intronic
1084409141 11:68996524-68996546 CCTGGCTACCCTGGCCGAACAGG + Intergenic
1084531311 11:69729466-69729488 CCTGGGGTCCCTGGTGGAGGAGG - Intergenic
1084774453 11:71366227-71366249 CCTGGGAGCCCTGGCCATCGTGG - Intergenic
1085405018 11:76256614-76256636 CCTGGGCTGCCTGGCCTAATGGG + Intergenic
1091243261 11:134069276-134069298 CCCGGGGTCCCGGGCCGGAGGGG + Intronic
1091384777 12:86322-86344 CCTGGGATCACTGGCTGAGATGG + Intronic
1092276470 12:7064966-7064988 CCTGAGATCCCTGCCCTAACTGG - Intronic
1092833736 12:12468799-12468821 CCTGGTTTCCCTGGTCAAAGTGG + Exonic
1093019172 12:14187243-14187265 TGTGGGATCCGTGGCAGAAGTGG + Intergenic
1094680554 12:32663392-32663414 CCTGTAATCCCAGGCCGAGGTGG - Intergenic
1095982716 12:47982181-47982203 CCTGGGGTGCCTGGCTGAGGCGG - Intronic
1096685895 12:53288131-53288153 CCTGGGAACCCTGGCCTGAATGG + Exonic
1097116553 12:56701634-56701656 CCTGTCATCCCAGGCCGAGGCGG + Intergenic
1098973392 12:76878673-76878695 CCTGGGATCCCAGGCCCGCGGGG - Intronic
1102345706 12:112159792-112159814 CCTGGGCTCCCTGGCCAGGGAGG + Intergenic
1102687130 12:114734018-114734040 CCTGGATTCCCAGTCCGAAGAGG + Intergenic
1103942398 12:124508184-124508206 CCTGGGAGCCCAGGCGGCAGTGG - Intronic
1104109402 12:125690592-125690614 CCTGGGATCCCTGCCCGCTAAGG - Intergenic
1104866895 12:131961216-131961238 CCTGGGCTCCCTGGGCGATCTGG - Exonic
1104885444 12:132104584-132104606 CCTGGGCTCCCTGGGCGATCTGG - Exonic
1106410162 13:29505977-29505999 CCTGGGATCCCCAGCCTGAGAGG - Intergenic
1111601651 13:90481978-90482000 CCTGTTAACCATGGCCGAAGTGG + Intergenic
1112365428 13:98752143-98752165 GCAGGGAACCCTGGCCCAAGAGG - Intronic
1113421600 13:110175312-110175334 CCTGGCATCCCTGGCCCACAAGG - Exonic
1113639889 13:111949680-111949702 CCTGGGATCGCTTCCCAAAGAGG + Intergenic
1113709983 13:112456823-112456845 CCTGGGACCCCTGGCCCTCGCGG - Intergenic
1116320296 14:43454173-43454195 CCTGGGATCCCTGGCAAAGGTGG + Intergenic
1116385632 14:44326251-44326273 GCTGGAATTCCTGGCAGAAGGGG + Intergenic
1118783619 14:69027335-69027357 CCTGTGATCCCTGGGAGCAGGGG + Intergenic
1122409316 14:101517925-101517947 CCTGGAAGCCCTGGCCCACGAGG - Intergenic
1122788444 14:104174495-104174517 CCTGAGGTCCCTGGCTGCAGTGG + Intronic
1123110244 14:105863829-105863851 CCAGGGTTCCCTGGCCCCAGGGG + Intergenic
1123463543 15:20496026-20496048 CCTGTAATCCCAGGCCGAGGCGG - Intergenic
1123654519 15:22504399-22504421 CCTGTAATCCCAGGCCGAGGCGG + Intergenic
1124274387 15:28313424-28313446 CCTGTAATCCCAGGCCGAGGCGG - Intronic
1124308429 15:28599595-28599617 CCTGTAATCCCAGGCCGAGGCGG + Intergenic
1124848088 15:33311036-33311058 CTCGGGAGCCATGGCCGAAGGGG + Exonic
1129230050 15:74192095-74192117 CCTGGGATCCCGGGCAGGAGTGG + Intronic
1131150755 15:90046033-90046055 CCTGGGAACCCTGGCTGGACGGG - Intronic
1132586274 16:706892-706914 GATGGGAAGCCTGGCCGAAGGGG + Intronic
1132726169 16:1339220-1339242 CCTGAGAGCCCTGGCCCCAGAGG + Exonic
1132826798 16:1909243-1909265 CCTCGGATCCCTGCCAGGAGGGG - Intergenic
1133240680 16:4412481-4412503 TCTGGGATCCCTGGGCAAGGAGG - Intronic
1133639816 16:7705927-7705949 CCATGCATCCCTGGCCAAAGTGG - Intronic
1137715721 16:50597144-50597166 CCTGGAATGCGTGGCAGAAGTGG + Intronic
1137729205 16:50677486-50677508 CCTGGGAGCCCTGGCTGCATGGG - Exonic
1138785989 16:59847314-59847336 CCAGGGATGCATGGCCAAAGAGG - Intergenic
1141098249 16:81178186-81178208 CCTGGGATCCCTTGCATCAGGGG - Intergenic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1144775140 17:17781555-17781577 CCTGGGGTGCTTGGCCGCAGGGG + Intronic
1144779988 17:17803196-17803218 ACTGGCATCACTGGCCCAAGGGG + Intronic
1144834733 17:18150892-18150914 CCTGAGATCCTTGCCCGCAGAGG + Exonic
1144845692 17:18217743-18217765 CCTGAGATCCCTGGCTGAGAAGG - Intergenic
1144858290 17:18283120-18283142 CCTGTAATCCCAGGCCGAGGCGG + Intronic
1147849073 17:43427296-43427318 ACCGTGATCCCTGGCCCAAGCGG + Intergenic
1151564930 17:74892765-74892787 CCTGGGAGCCCAGGCTAAAGTGG + Intronic
1151703696 17:75756099-75756121 CCTAGGATCCCAGCCCAAAGGGG - Intronic
1151817520 17:76478650-76478672 GCTGGGATCCCTGGGCAAAGAGG - Intronic
1151954005 17:77371733-77371755 CCCGGGCTCCCAGGCCGACGAGG + Intronic
1152792436 17:82288736-82288758 CCTGGGTTACCTGGCCAATGCGG - Intergenic
1153480653 18:5543576-5543598 CCTGGGATCCCTGGCCGAAGGGG - Intronic
1153960476 18:10135925-10135947 CCAGGGATTCCTGGTCAAAGAGG - Intergenic
1154387629 18:13909822-13909844 TCAGGGATCCCTGGGGGAAGTGG - Intronic
1157291634 18:46413634-46413656 CCTGGGAACCCAGGGCAAAGGGG + Intronic
1157310369 18:46548127-46548149 CCTGGGATCTCTGGACGCTGTGG + Intronic
1160156824 18:76441193-76441215 CCTGGGATCCCAGGCTCAGGGGG - Intronic
1160602453 18:80024117-80024139 TCAGGGATCCCTGGAGGAAGAGG - Intronic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161506181 19:4644962-4644984 CCTGGGATCACTGGCCTCGGCGG + Intronic
1161818965 19:6517201-6517223 CCTGGGTTCCCTGGCGGGAGTGG + Intergenic
1162366449 19:10252399-10252421 CCTGAGTTCCCTGGCGGAAGAGG + Exonic
1162479485 19:10920322-10920344 CCAGGGGTCCCTGGCAGAGGGGG + Intronic
1162961870 19:14132871-14132893 CCTGTAATCCCAGGCCGAGGCGG + Intronic
1163448125 19:17359648-17359670 CCTGTAATCCCAGGCCGAGGTGG - Intronic
1163699622 19:18780814-18780836 CCTGGGATGCTGGGCAGAAGTGG - Exonic
1163834426 19:19564508-19564530 CCTGTAATCCCAGGCCGAGGCGG - Intronic
1166511952 19:43415094-43415116 CCTGGGCTCCCGGGCCTGAGAGG + Intronic
1166852306 19:45766674-45766696 CCTGGGGCCCCTGGCCCAAGTGG - Exonic
1166874831 19:45890915-45890937 ACTGGGGTTCCTGGCAGAAGGGG + Exonic
1167306572 19:48713405-48713427 CGTGGGGTCCCTGGGAGAAGGGG + Exonic
1168102015 19:54146321-54146343 CCTTGGATCCCTGCCCAAGGTGG - Intronic
1168373780 19:55858587-55858609 CCTGTGCTCCCTGGCTGCAGAGG + Exonic
925010919 2:485653-485675 TTGGGGATCCCTGGCCCAAGAGG - Intergenic
925016382 2:527805-527827 GCTGGGAGCCCTGGTCAAAGGGG + Intergenic
929563809 2:42972051-42972073 CCTGGGATCCCTGGTGGCATTGG - Intergenic
929936546 2:46297851-46297873 CCTGGGCTCCCTGGCGGGTGGGG - Exonic
932108373 2:68970121-68970143 CATGGCTTCCCTGGCAGAAGAGG - Intergenic
932398907 2:71466404-71466426 CCCGGGATCCCTGGCTGGTGTGG + Intronic
933682188 2:85111989-85112011 CCTGGGTCACCTGGCCTAAGTGG - Intergenic
935164974 2:100562598-100562620 CCTGTGATCCCAGGCCGAGGCGG - Intergenic
937293732 2:120797598-120797620 CCTGGGATTCCTGGGAGCAGAGG - Intronic
937856404 2:126674747-126674769 CCTGGGAGCTCTGGCTGGAGGGG + Intronic
938229610 2:129647189-129647211 CCTGGTATCCCTAGCAGCAGGGG + Intergenic
939187763 2:138880675-138880697 CCTGGGATCACTGCCTTAAGAGG + Intergenic
945722289 2:213432917-213432939 CCTGGTATCCCTGGCAGTGGGGG - Intronic
949044577 2:241866625-241866647 CCTGGGATCCCTGCCCGCCTGGG + Intergenic
1169875962 20:10297292-10297314 CCTGGGCTCTCTTGCTGAAGAGG - Intronic
1176106432 20:63391767-63391789 CCTGGGCCCCCGGGCCCAAGGGG + Intergenic
1179314028 21:40225369-40225391 CCTGAGATCGCTGGGGGAAGAGG - Intronic
1179801323 21:43812750-43812772 CCAGGGCTCCCTGGCTGAAGTGG + Intergenic
1181041556 22:20194936-20194958 CCTGGGGTCCATGACAGAAGAGG - Intergenic
1181042792 22:20200540-20200562 CCTGTGATCCCTGCCCTCAGTGG + Intergenic
1183529125 22:38343124-38343146 CCTGTAATCCCAGGCTGAAGCGG + Intronic
1184379565 22:44136583-44136605 GCTGGTGTCCCTGGCTGAAGTGG - Intronic
1185081735 22:48713325-48713347 CCTGGGATGCCTGGCCGGGGTGG - Intronic
951283391 3:20779898-20779920 CCTGGAATACCTGCCCAAAGAGG - Intergenic
953471945 3:43175102-43175124 CCTGAGAGCCCTGGTAGAAGCGG - Intergenic
954116471 3:48469441-48469463 GCTGGCATCCCTGGCTGAGGCGG + Exonic
954510598 3:51121439-51121461 CCTGGGATTCCTGGGCAAGGTGG - Intronic
955138411 3:56243990-56244012 CCTGGGATGCCTCGCCAAAGAGG + Intronic
957723179 3:84031340-84031362 CTTTGGATCCCTGGCAGGAGGGG + Intergenic
958951686 3:100423933-100423955 CTTGGGAGCCCTGGCCTGAGGGG - Intronic
961861057 3:129917063-129917085 TCTGGGATCCAGGGCAGAAGGGG + Intergenic
962244294 3:133778683-133778705 CCTGGTTTCACTGGCCCAAGTGG + Exonic
965719385 3:171644967-171644989 CCTTCGAACCCTGGCAGAAGTGG + Exonic
966725510 3:183104236-183104258 ACTGGGAGCCCAGGCAGAAGAGG + Intronic
968286449 3:197511851-197511873 TCAGGGATCCCTGGTGGAAGGGG - Exonic
968480048 4:829227-829249 CCTGGGGTCCCTGGCCTCACTGG - Intergenic
980474943 4:133301313-133301335 CCTGGGATCCCTCGCAGCACTGG - Intergenic
985694297 5:1331256-1331278 CCTGGGCTGCCTGGCCTCAGGGG + Intronic
993246619 5:85459865-85459887 ACTGGGATCCCAGGCCAATGGGG + Intergenic
996045855 5:118873093-118873115 CTCTGGATCCCTGGCAGAAGGGG + Intronic
997681438 5:135756424-135756446 CCTGTGATCCCAGGCCAAGGTGG + Intergenic
998004433 5:138647768-138647790 CCTGGGGTCCCTGACTGCAGAGG + Intronic
998041864 5:138955599-138955621 CCTGGGCCCCCTGGCCGAGCTGG - Intronic
1003864566 6:10351270-10351292 CCTGTAATCCCAGGCCGAGGCGG + Intergenic
1005915254 6:30345487-30345509 CCAGGGATCCCTCGGTGAAGAGG + Exonic
1006298174 6:33179256-33179278 CCTGGGAGCCCTGGCCTGAAAGG - Exonic
1014725207 6:124963747-124963769 TCTGGGATACCAGGCCGATGAGG - Intronic
1016461933 6:144286584-144286606 CCTCGGACCCCGGGCCAAAGCGG - Intronic
1016605060 6:145911379-145911401 CCTGTAATCCCAGGCCGAAGTGG - Intronic
1018845408 6:167552039-167552061 CCTGGGAGCCCTTGCTCAAGGGG - Intergenic
1019277435 7:183195-183217 CCTGGGAGTCCTGGCCCGAGGGG - Intergenic
1020883283 7:13791251-13791273 CCTGGGAACCTTTGCCTAAGTGG - Intergenic
1022465195 7:30648932-30648954 GCCGGGCTCCCTGGCTGAAGGGG + Intergenic
1023557671 7:41439965-41439987 CCTGGAATCCCTGGAGAAAGCGG + Intergenic
1024157204 7:46638031-46638053 CCTAGGAGCCCTGGCAGAACTGG + Intergenic
1026666373 7:72343297-72343319 CCTGTAATCCCAGGCCGACGCGG + Intronic
1027125409 7:75553521-75553543 CCTGGCCTCCCTGGAGGAAGAGG - Exonic
1028673842 7:93435558-93435580 CCTGTAATCCCAGGCCGAGGCGG + Intronic
1029250249 7:99231194-99231216 CCTGTAATCCCAGGCCGAGGCGG - Intergenic
1030296314 7:107932191-107932213 CCTGAGTGCCCTGGCTGAAGTGG - Exonic
1032095201 7:128934828-128934850 CCTGAGAGCCCAGGCCGAGGGGG + Intergenic
1035363357 7:158328801-158328823 CCTGGGATCCCTGGGTGGCGGGG - Intronic
1037422880 8:18722719-18722741 CAGGGCATCCCAGGCCGAAGAGG - Intronic
1037811473 8:22089404-22089426 CCGGGGGTCCCTGCCCGAGGGGG - Intronic
1038021767 8:23557221-23557243 CCTAGGCTCCTTGGCAGAAGAGG - Intronic
1039002452 8:32996217-32996239 CCTGCAATCCTTGGCCGCAGTGG - Intergenic
1039451754 8:37680483-37680505 CGTGGCAAACCTGGCCGAAGTGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1041442093 8:57908074-57908096 CCTGTAATCCCAGGCCGAGGCGG - Intergenic
1048844000 8:138589380-138589402 CCTGGGATCCCTGGCCCTCAAGG - Exonic
1049597377 8:143491080-143491102 CCTGGGCTCCCTGGAGGGAGGGG - Intronic
1049682218 8:143924492-143924514 CCTGCGTGCCCTGGCGGAAGAGG - Exonic
1050565051 9:6873242-6873264 CCTGTAATCCCAGGCCGAGGCGG - Intronic
1057802192 9:98197321-98197343 CCTGGGAGCTCTGGCCCAGGCGG - Intergenic
1058821399 9:108733553-108733575 CCTGGGATGCAAGGCTGAAGTGG - Intergenic
1058858308 9:109088570-109088592 CCTGTAATCCCAGGCCGAGGCGG + Intronic
1060790528 9:126482803-126482825 CCTTGGAGCCCTGGCCGAGGTGG - Intronic
1061035988 9:128114661-128114683 CCTGAGATCCCAGGCCCGAGAGG - Intergenic
1061307265 9:129739386-129739408 CCTTGGATTCCTGCACGAAGTGG - Exonic
1061308132 9:129744327-129744349 CCTGTGATCTCAGGCTGAAGTGG + Intronic
1061377746 9:130236188-130236210 CCTGGGATCCCTTCCTGGAGAGG + Exonic
1061868209 9:133506264-133506286 CCTGGGCCCCCTGGCTAAAGGGG + Intergenic
1061883363 9:133578891-133578913 CCTGGAATCCCTGTCCTCAGGGG - Exonic
1185599369 X:1328197-1328219 CCTGGGATCCCTGGGGAAGGGGG + Intergenic
1185894073 X:3843207-3843229 GCTGGGATCCCGAGCCGCAGCGG + Intronic
1185899191 X:3881631-3881653 GCTGGGATCCCGAGCCGCAGCGG + Intergenic
1185904308 X:3920060-3920082 GCTGGGATCCCGAGCCGCAGCGG + Intergenic
1186850725 X:13577143-13577165 CCTGGCTTCCCTGGCCAAAAAGG - Intronic
1187334961 X:18373928-18373950 CCTGGGATCCCTGCATGAACTGG + Intergenic
1188469742 X:30524937-30524959 CCTGCAATCCCAGGCCGAATTGG + Intergenic
1189437069 X:41002322-41002344 CCTGGGCTACGTGGCCAAAGAGG + Intergenic
1190100356 X:47518091-47518113 CCTGGGCTCCCTGGGGGATGGGG + Intergenic
1191641250 X:63431330-63431352 CCTGATATCCCTGGCCATAGAGG + Intergenic
1192968257 X:76202793-76202815 CCTGTGATGCCAGGCAGAAGTGG + Intergenic
1198025973 X:132707577-132707599 CCTGTGCTCCCTGGCCAAATAGG - Intronic
1200056299 X:153463173-153463195 CCTGGGCACCCTGGCAGATGTGG - Intronic
1200063889 X:153495791-153495813 CCTGGGAGCCCTGGCTGCAAGGG + Intronic