ID: 1153481456

View in Genome Browser
Species Human (GRCh38)
Location 18:5551352-5551374
Sequence TCTGTTTTACTAGCACAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153481451_1153481456 27 Left 1153481451 18:5551302-5551324 CCACTTCTCTTGATGTGATATCA 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1153481456 18:5551352-5551374 TCTGTTTTACTAGCACAGACGGG 0: 1
1: 0
2: 1
3: 16
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153481456 Original CRISPR TCTGTTTTACTAGCACAGAC GGG Intronic
900846116 1:5102527-5102549 TTTGTATTACTAGTAGAGACGGG + Intergenic
901392075 1:8952826-8952848 TTTGTATTTCTAGTACAGACAGG + Intronic
901433141 1:9230381-9230403 TTTGTTTTTTTAGTACAGACGGG + Intergenic
901670099 1:10851073-10851095 TCTGTATTTTTAGTACAGACAGG + Intergenic
902040928 1:13491845-13491867 TTTGTATTTTTAGCACAGACAGG + Intronic
902265154 1:15258011-15258033 TTTGTATTTCTAGTACAGACGGG + Intronic
902277089 1:15347618-15347640 TTTGTATTTCTAGTACAGACGGG + Intronic
902308128 1:15559109-15559131 TCTGTATTTTTAGCAGAGACGGG + Intronic
902905293 1:19552176-19552198 TTTGTATTTTTAGCACAGACAGG - Intergenic
903870567 1:26431552-26431574 TCTGTATTTTTAGTACAGACGGG + Intergenic
903936454 1:26898487-26898509 TTTGTATTTCTAGTACAGACAGG + Intronic
904070999 1:27797226-27797248 TTTGTATTATTAGCAGAGACAGG + Intronic
904089135 1:27932271-27932293 TCTGTTATAACAGCACAGAAAGG + Intergenic
904486920 1:30831165-30831187 TTTGTATTTTTAGCACAGACGGG + Intergenic
904727017 1:32556703-32556725 TCTGTATTTTTAGTACAGACAGG - Intronic
905072030 1:35234729-35234751 TTTGTATTTTTAGCACAGACAGG - Intergenic
907133926 1:52121436-52121458 TTTGTATTTTTAGCACAGACAGG + Intergenic
907171600 1:52471186-52471208 TCTGTATTTTTAGCAGAGACAGG + Intronic
907543110 1:55234500-55234522 TCTGTATTTTTAGCAGAGACGGG - Intergenic
907867863 1:58416238-58416260 TCTGTGTGACTAGCACTGCCAGG - Intronic
908039160 1:60088801-60088823 TCTGTTTTACTGCCACCGAGTGG - Intergenic
909892892 1:81029798-81029820 TCTGTATTTTTAGTACAGACGGG - Intergenic
910786766 1:91007383-91007405 TCTGTATTTTTAGCAGAGACAGG + Intronic
910901738 1:92128589-92128611 TTTTTTTTTTTAGCACAGACAGG + Intronic
911021587 1:93394326-93394348 TCTGTATTTTTAGTACAGACGGG - Intergenic
914685362 1:149974028-149974050 TCTATTTTTTTAGTACAGACAGG + Intronic
914749102 1:150520970-150520992 TCTGTATTTTTAGCAGAGACAGG + Intergenic
915193819 1:154174159-154174181 TTTGTATTTCTAGTACAGACAGG - Intronic
915508906 1:156375242-156375264 TTTGTTTTATTAGTAGAGACGGG + Intronic
915983876 1:160443572-160443594 TCTGTATTTCTAGTAGAGACGGG - Intergenic
916288768 1:163140346-163140368 TCTGTATTATTAGTAGAGACGGG + Intronic
916405050 1:164489883-164489905 TCTCTTTCACAAGCACATACTGG + Intergenic
917416793 1:174818835-174818857 TCTTTTTTACTGGTAGAGACGGG - Intronic
917568313 1:176234968-176234990 TTTGTATTATTAGTACAGACGGG + Intergenic
918128679 1:181606293-181606315 GCTGTTTTACTAGGACAGGCAGG - Intronic
918237288 1:182592854-182592876 TCTGTATTTTTAGTACAGACAGG + Intergenic
918857992 1:189783227-189783249 TCTGGTTTTCTAGCACTGATAGG + Intergenic
919648215 1:200118186-200118208 TCTGTATTTTTAGCACAGATGGG + Intronic
921800906 1:219400664-219400686 TTTGTATTATTAGTACAGACAGG + Intergenic
922362449 1:224835798-224835820 TCTGTATTTCTAGTAGAGACGGG + Intergenic
922658618 1:227409083-227409105 TTTGTATTTTTAGCACAGACAGG - Intergenic
922961151 1:229646714-229646736 TTTGTTTCACTAGAACAGTCTGG + Intronic
923140568 1:231158939-231158961 TCTGTATTTTTAGTACAGACAGG + Intergenic
923234860 1:232022477-232022499 TTTGTATTATTAGCAGAGACAGG + Intronic
923280657 1:232439960-232439982 TCGGTATTACAAGCACAGAGAGG - Intronic
923494250 1:234510742-234510764 TTTGTATTTTTAGCACAGACGGG + Intergenic
923533982 1:234834350-234834372 TCTTTTTTAATAACACAGATGGG + Intergenic
923577600 1:235174210-235174232 TTTGTTTTATTAGTAGAGACAGG + Intronic
923843809 1:237706075-237706097 TTTGTATTTTTAGCACAGACGGG - Intronic
923919961 1:238552825-238552847 TTTGTATTATTAGCAGAGACGGG + Intergenic
924253930 1:242163314-242163336 TTTGTATTTTTAGCACAGACGGG + Intronic
924863387 1:247950825-247950847 TCTGTTGTGCTACCACATACTGG - Intronic
1063373545 10:5537874-5537896 ACAGTTTTTCTTGCACAGACAGG + Intergenic
1063734136 10:8733229-8733251 TCTGTGTTTTTAGTACAGACGGG - Intergenic
1064031216 10:11884535-11884557 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1064205940 10:13323524-13323546 TCTGTATTTTTAGCAGAGACAGG + Intronic
1065608124 10:27442106-27442128 TTTGTATTTCTAGCAGAGACAGG - Intergenic
1065619441 10:27565543-27565565 TCTGTTTTAGCAGCACAAAATGG - Intergenic
1065679848 10:28217978-28218000 TCTGATTTACTAACACATATTGG + Intronic
1066031441 10:31429910-31429932 TTTGTATTTCTAGCAGAGACAGG + Intronic
1066093017 10:32044498-32044520 TTTGTGTTACTAGTAGAGACAGG - Intronic
1068199692 10:53766893-53766915 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1069007574 10:63335680-63335702 TCTGTATTTTTAGTACAGACGGG + Intronic
1070228738 10:74541184-74541206 TTTGTATTACTAGTAGAGACGGG + Intronic
1071058638 10:81542606-81542628 TTTGTATTTCTAGTACAGACAGG + Intergenic
1072238064 10:93470055-93470077 TTTGTTTTTTTAGCAGAGACTGG - Intronic
1072865107 10:99051097-99051119 TCTGTCTTTTTAGCAGAGACGGG - Intronic
1072918825 10:99558364-99558386 TTTGTATTATTAGCAGAGACGGG - Intergenic
1073125939 10:101149308-101149330 TCTGTGTTATTAGAACAGCCTGG - Intergenic
1073177949 10:101568029-101568051 CCTGTCTTACTAGCTCAGCCTGG - Intergenic
1073383325 10:103099244-103099266 TCTGTATTTCTTGTACAGACAGG + Intronic
1073596025 10:104801056-104801078 TCACTTTTTCTAGCATAGACAGG + Intronic
1074536068 10:114329371-114329393 TGTGTTTTACAAGCACAGCATGG - Intronic
1074586445 10:114771827-114771849 TCTTTTTTTCAAACACAGACTGG - Intergenic
1074740346 10:116480236-116480258 TTTGTATTTTTAGCACAGACGGG - Intergenic
1075337816 10:121621294-121621316 TTTGTATTATTAGCAGAGACAGG - Intergenic
1075367459 10:121905128-121905150 TTTGTTTTTCTTGTACAGACAGG - Intronic
1075367928 10:121909159-121909181 TTTGTATTTCTAGTACAGACAGG + Intronic
1076639342 10:131903293-131903315 TCTGTATTTTTAGCAGAGACGGG - Intronic
1077004629 11:347458-347480 TGTGTGTTACTAGTAGAGACAGG + Intergenic
1077104394 11:835858-835880 TTTGTATTTCTAGTACAGACGGG + Intronic
1077733235 11:4758938-4758960 TTTGTATTTCTAGCAGAGACGGG - Intronic
1077820533 11:5734349-5734371 TCTGTTTTAGTAGCATATAGAGG + Intronic
1077975387 11:7242872-7242894 TTTGTATTATTAGCAGAGACAGG - Intronic
1078290130 11:10001697-10001719 TCTATTTTTTTAGTACAGACGGG + Intronic
1079074745 11:17377303-17377325 TTTGTATTATTAGTACAGACGGG - Exonic
1079932126 11:26577383-26577405 TCTGTATTTTTAGTACAGACGGG - Intronic
1079966549 11:26987180-26987202 TCTGTTATAGTAGCCCAAACAGG + Intergenic
1083543957 11:63535537-63535559 TCTGTATTTTTAGCAGAGACGGG + Intergenic
1083672958 11:64309758-64309780 TTTGTATTTCTAGTACAGACAGG - Intronic
1083689548 11:64398863-64398885 TCTGTTTTAACAGCACAAAATGG + Intergenic
1084007383 11:66330593-66330615 TTTGTGTTACTAGTAGAGACGGG - Intronic
1084132048 11:67143802-67143824 TCTGTATTTTTAGTACAGACAGG + Intronic
1085618375 11:78019183-78019205 TTTGTATTTTTAGCACAGACTGG + Intronic
1086189873 11:84066586-84066608 TTTGTATTTTTAGCACAGACAGG - Intronic
1086372413 11:86168452-86168474 TGTGTGTTTTTAGCACAGACGGG - Intergenic
1088654033 11:111982210-111982232 CCTGTTCTCATAGCACAGACTGG - Intronic
1089909710 11:122084800-122084822 TTTGTATTTTTAGCACAGACAGG - Intergenic
1089934239 11:122347166-122347188 TGTATTTTTTTAGCACAGACGGG + Intergenic
1090020585 11:123125067-123125089 TCTGTATTTTTAGCAGAGACAGG + Intronic
1092346975 12:7723451-7723473 TTTGTATTATTAGTACAGACGGG - Intergenic
1092615256 12:10211075-10211097 TCTGTATTATTAGTAGAGACGGG + Intergenic
1092822952 12:12370920-12370942 TCTGTATTTTTAGCAGAGACGGG + Intronic
1092885318 12:12919601-12919623 TCTGTATTTCTAGTAGAGACGGG + Intergenic
1093009679 12:14093527-14093549 TCTGTTATAGTAGCACAAAATGG - Intergenic
1093623348 12:21318290-21318312 TTTGTATTTCTAGCAGAGACGGG + Intronic
1093949068 12:25143419-25143441 TCTGTATTTTTAGCAGAGACAGG + Intronic
1094405992 12:30116734-30116756 TCTGTATTACTAGCAATGGCTGG - Intergenic
1094620728 12:32078060-32078082 TCTGTTATAGCAGCACAGAATGG - Intergenic
1094819869 12:34216101-34216123 TTTGTTTTATTAGTAGAGACAGG - Intergenic
1095736900 12:45567538-45567560 TCTGTTTTCCTATCATAGAGAGG + Intergenic
1095760427 12:45827510-45827532 TCTGTTTTCCTATCATAGAATGG - Intronic
1096906355 12:54940109-54940131 TTTGTATTTCTAGCAGAGACAGG - Intergenic
1097761800 12:63474740-63474762 TTTGTATTTTTAGCACAGACAGG - Intergenic
1097767619 12:63543575-63543597 TTTTTTTTTCTAGCAGAGACAGG + Intergenic
1097795941 12:63861947-63861969 TTTGTGTTATTAGCAGAGACGGG - Intronic
1098127769 12:67318099-67318121 TGTGTTTTTTTAGCAAAGACGGG - Exonic
1098189880 12:67936801-67936823 TCTGTATTTTTAGCAGAGACGGG + Intergenic
1098340868 12:69449693-69449715 TCTGTTATAGTAGCACAAAATGG + Intergenic
1098977411 12:76917617-76917639 TCTGTTGTAGTAGCACAAAATGG - Intergenic
1099323470 12:81180685-81180707 TTTGTATTATTAGCAGAGACAGG + Intronic
1099631193 12:85147431-85147453 TCTGTATGAATAACACAGACAGG + Intronic
1100143870 12:91653320-91653342 TTTGTATTATTAGCACAGACAGG - Intergenic
1100307093 12:93360765-93360787 TCTGTTATAGTAGCACAGAATGG - Intergenic
1101071428 12:101080071-101080093 TCTGATTTACTGGCACAGCAAGG - Intronic
1101547184 12:105726148-105726170 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1101909727 12:108852401-108852423 TCTGTTTTTTTAGTAGAGACAGG + Intronic
1103165477 12:118766809-118766831 CCTGTTTTTCAAGCACAAACAGG - Intergenic
1103177229 12:118875088-118875110 GCTGCTTAACTAGCAGAGACTGG + Intergenic
1103672837 12:122632316-122632338 TTTGTATTTTTAGCACAGACAGG - Intergenic
1103794916 12:123496724-123496746 TCTGTGTTCCTGGCACAGTCTGG + Intronic
1105380598 13:19883926-19883948 TCTGTATTTTTAGTACAGACGGG + Intergenic
1106811708 13:33364714-33364736 TCTGTATTTTTAGTACAGACGGG - Intergenic
1106869677 13:34005138-34005160 TCTGTATTTTTAGTACAGACGGG - Intergenic
1107494564 13:40913298-40913320 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1107963516 13:45579337-45579359 TCTGTTTTACTTGAACATAGGGG - Intronic
1108002854 13:45920832-45920854 TCTGTATTTTTAGTACAGACAGG - Intergenic
1108078060 13:46702328-46702350 TTTGTATTATTAGTACAGACAGG - Intronic
1108203443 13:48064144-48064166 TCTGTATTTCTAGTAGAGACAGG + Intronic
1108559737 13:51630949-51630971 TCTGTATTTTTAGTACAGACGGG + Intronic
1110039027 13:70728546-70728568 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1111320527 13:86622029-86622051 TCTGTTTTAGCAACACAGACTGG - Intergenic
1112022614 13:95384804-95384826 TTTGTATTTCTAGTACAGACAGG + Intergenic
1112355024 13:98667036-98667058 TATGTTTTAGTAGAACAGGCTGG - Intergenic
1114247140 14:20924910-20924932 TTTGTATTACTAGTAGAGACAGG + Intergenic
1114951199 14:27756362-27756384 TCTGTTTTAGAAGCACAAAATGG - Intergenic
1115475292 14:33807623-33807645 TCTGCTTTATTAGCACAAACTGG + Intergenic
1115602413 14:34968098-34968120 TCTGTATTTTTAGTACAGACGGG + Intergenic
1116082505 14:40192843-40192865 TCTGTATTTCTAGTACAGACTGG - Intergenic
1117184192 14:53223220-53223242 TCTGTTTTTTTAGTAGAGACAGG + Intergenic
1117717200 14:58593631-58593653 TCAGTTTTAATAGGACAGAAGGG + Intergenic
1117863771 14:60122833-60122855 TTTTTTGTACTAGCACAGATTGG + Intronic
1118011283 14:61613036-61613058 TTTGTATTTTTAGCACAGACAGG + Intronic
1118586962 14:67362436-67362458 TATGTTTGACTAGCACATAATGG + Intronic
1119119666 14:72062993-72063015 TCTGTATTTTTAGCAGAGACAGG + Intronic
1119591119 14:75888760-75888782 TTTGTATTTCTAGCAGAGACGGG - Intronic
1120798894 14:88667697-88667719 GCTGTTTTACTAACAGAGCCCGG + Intronic
1121226710 14:92326578-92326600 TCTGTTCTCCTGCCACAGACAGG + Intronic
1122527799 14:102400858-102400880 TCTGTTTTTTTAGTAGAGACGGG - Intronic
1123685302 15:22792780-22792802 TCTGTATTTTTAGTACAGACGGG - Intronic
1123911613 15:24973569-24973591 TTTGTATTTCTAGCAGAGACGGG + Intronic
1124269007 15:28263858-28263880 TCTGTATTTTTAGTACAGACAGG - Intronic
1125684624 15:41556563-41556585 TTTGTATTATTAGTACAGACAGG - Intergenic
1126014894 15:44341251-44341273 TTTGTATTTCTAGCAGAGACGGG + Intronic
1126567635 15:50116244-50116266 TTTATTTTACTTGAACAGACAGG - Intronic
1126831888 15:52616161-52616183 TATGTTATAAGAGCACAGACAGG + Intronic
1126887518 15:53166551-53166573 TCTGTTTTATTAGCATAAAGAGG - Intergenic
1127882066 15:63166877-63166899 TCTGTATTATTAGTAGAGACGGG - Intergenic
1128397107 15:67238866-67238888 TCTGTATTTTTAGTACAGACAGG + Intronic
1128645807 15:69378089-69378111 TTTGTATTACTAGTAGAGACAGG - Intronic
1128881132 15:71243956-71243978 TCTGTTTTTTTAGTAGAGACGGG + Intronic
1129195305 15:73961228-73961250 TCTGTATTTTTAGCAGAGACAGG + Intergenic
1129902198 15:79159654-79159676 TCTGTTATAGCAGCACAGAATGG + Intergenic
1130074122 15:80674124-80674146 TCTGTCATAATAGCACAGATAGG - Intergenic
1130934934 15:88460910-88460932 TCTGTATTTTTAGTACAGACGGG + Intronic
1131735836 15:95331474-95331496 TTTGTTTTACTAGCACAATGGGG - Intergenic
1132413428 15:101603156-101603178 TCTGAGTTCCAAGCACAGACAGG + Intergenic
1132487210 16:200247-200269 TCTGTTTTTTTAGTAGAGACGGG - Intronic
1133177692 16:4027703-4027725 TTTGTTTTACTAGTAGAGATGGG - Intronic
1133179459 16:4042093-4042115 TTTGTTTTTTTAGCAGAGACGGG + Intronic
1133330222 16:4968348-4968370 TTTGTATTTTTAGCACAGACGGG + Intronic
1135375794 16:21946143-21946165 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1135679716 16:24446018-24446040 TCTGTATTTTTAGCAGAGACAGG - Intergenic
1136252745 16:29016978-29017000 TTTGTTTTATTAGTAGAGACAGG + Intergenic
1136463258 16:30425049-30425071 TTTGTTTTTCTAGTAGAGACAGG + Intronic
1136480441 16:30538437-30538459 TCTGTATTTCTAGTAGAGACGGG + Intronic
1138089467 16:54162484-54162506 TCTGTATTTTTAGTACAGACGGG + Intergenic
1138640943 16:58386393-58386415 TTTGTATTTTTAGCACAGACAGG - Intronic
1139686762 16:68609958-68609980 TTTGTATTATTAGTACAGACGGG - Intergenic
1139872930 16:70122156-70122178 TCTGTTTTTTTAGTAGAGACAGG + Intronic
1140362850 16:74359155-74359177 TCTGTTTTTTTAGTAGAGACAGG - Intergenic
1140854912 16:78969440-78969462 TTTGTATTTCTAGTACAGACAGG + Intronic
1140923326 16:79559504-79559526 TCCGTTCTACTAGCAAAGCCAGG + Intergenic
1142324155 16:89403218-89403240 TCTGCTTTACGGGCACTGACAGG + Intronic
1142663353 17:1446764-1446786 TCTGTATTTCTAGTAGAGACGGG + Intronic
1142736517 17:1903867-1903889 TCTGTATTTCTAGTAGAGACAGG + Intergenic
1142755272 17:2012963-2012985 TTTGTATTTTTAGCACAGACAGG + Intronic
1143833547 17:9671600-9671622 TGAGTTTTAATAGCACTGACGGG + Intronic
1144706690 17:17373194-17373216 TCTGGCTTCCCAGCACAGACTGG + Intergenic
1144806150 17:17969226-17969248 TTTGTATTACTAGTAGAGACAGG + Intronic
1146247921 17:31307191-31307213 TTTGTATTTTTAGCACAGACGGG + Intronic
1146568370 17:33932540-33932562 TTTGTATTTTTAGCACAGACAGG - Intronic
1146772328 17:35580361-35580383 TTTGTATTTCTAGTACAGACTGG - Intronic
1146857953 17:36270713-36270735 TTTGTATTTCTAGTACAGACGGG - Intronic
1146887254 17:36480600-36480622 TTTGTTTTTTTAGTACAGACAGG - Intergenic
1147057466 17:37845375-37845397 TCTGTTTTTTTTGTACAGACGGG - Intergenic
1147076747 17:37995249-37995271 TTTGTATTTCTAGTACAGACGGG - Intronic
1147077056 17:37997810-37997832 TTTGTATTTCTAGTACAGACGGG + Intronic
1147088273 17:38074795-38074817 TTTGTATTTCTAGTACAGACGGG - Intergenic
1147108937 17:38245722-38245744 TTTGTATTTCTAGTACAGACGGG + Intergenic
1147190811 17:38736959-38736981 TCTGTTTTTTTAGTAGAGACGGG - Intronic
1147476538 17:40716957-40716979 TTTGTATTGCTAGAACAGACAGG - Intergenic
1147932482 17:43991256-43991278 TTTGTATTATTAGCAGAGACAGG - Intronic
1148511263 17:48171887-48171909 TTTGTATTTTTAGCACAGACGGG - Intronic
1148707400 17:49647650-49647672 TCTGTATTTTTAGCAGAGACGGG + Intronic
1149546905 17:57510597-57510619 TCTGTATTATTAGTAGAGACAGG + Intronic
1150515918 17:65809105-65809127 TCTGTTATAGTAGCACATAATGG + Intronic
1150683962 17:67305304-67305326 TTTGTGTTTCTAGCAGAGACGGG - Intergenic
1151076637 17:71280896-71280918 TTTGTATTATTAGCAGAGACGGG + Intergenic
1151223824 17:72633878-72633900 TATGTTTTAAAAGGACAGACTGG + Intergenic
1151260853 17:72914967-72914989 TCTGCTTTAGTGGCACAGGCTGG + Intronic
1151385793 17:73754418-73754440 TCTGTATTTTTAGTACAGACTGG - Intergenic
1151406794 17:73892890-73892912 TTTGTTATAGTAGCACAAACGGG + Intergenic
1151412616 17:73941307-73941329 TTTGTATTATTAGCAGAGACAGG + Intergenic
1152996283 18:409360-409382 TTTGTTTTATTAGTAGAGACGGG - Intronic
1153020339 18:623202-623224 TTTGTATTTCTAGCAGAGACAGG + Intronic
1153273313 18:3344386-3344408 TTTGTATTATTAGCACAGACAGG - Intergenic
1153274386 18:3353535-3353557 TTTGTATTATTAGCACAGATAGG + Intergenic
1153481456 18:5551352-5551374 TCTGTTTTACTAGCACAGACGGG + Intronic
1154095397 18:11410053-11410075 TTTGTATTACTAGTAGAGACGGG - Intergenic
1155457536 18:26034698-26034720 TCAGTTTTCCCAGCACACACAGG + Intronic
1155483529 18:26316029-26316051 TCTGTATTTTTAGTACAGACAGG - Intronic
1156418818 18:36928144-36928166 TCTGTTTTAAGAGCATAGACTGG + Intronic
1156507953 18:37610587-37610609 TCTGTTTTATTTCCACAGATGGG - Intergenic
1156576301 18:38319876-38319898 TGTGTTTTTTTAGCAGAGACGGG - Intergenic
1156756029 18:40527126-40527148 TTTGTATTATTAGCAGAGACAGG + Intergenic
1157934778 18:51860826-51860848 TCTGTATTTTTAGCAGAGACGGG + Intergenic
1159208172 18:65281130-65281152 TTTGTATTACTAGTAGAGACTGG + Intergenic
1160709809 19:545949-545971 TCTGTATTTTTAGTACAGACGGG + Intronic
1160815073 19:1031401-1031423 TTTGTATTATTAGTACAGACGGG - Intronic
1161176118 19:2842869-2842891 TTTGTATTTCTAGCAGAGACGGG - Intronic
1161289761 19:3487075-3487097 TCTGTATTTTTAGCAGAGACAGG + Intergenic
1161689887 19:5725727-5725749 TCTGTATTTCTAGTAGAGACGGG - Intronic
1161860978 19:6798103-6798125 TCTGTATTTTTAGTACAGACAGG - Intronic
1161937111 19:7378862-7378884 TTTGTATTTCTAGTACAGACGGG + Intronic
1162103394 19:8354385-8354407 TTTGTATTTCTAGCAGAGACTGG - Intronic
1162368382 19:10263557-10263579 TCTGTTTTGTTAGCAGAGATGGG + Intergenic
1162484192 19:10948772-10948794 TCTGTATTTTTAGCAGAGACGGG + Intergenic
1162850560 19:13428097-13428119 TTTGTATTATTAGCAGAGACAGG + Intronic
1163051537 19:14688423-14688445 TTTGTATTACTAGTAGAGACTGG + Intronic
1163215034 19:15870270-15870292 TTTGTATTATTAGCAGAGACGGG - Intergenic
1163512412 19:17743343-17743365 TCTGTATTTTTAGTACAGACAGG + Intergenic
1164051689 19:21589390-21589412 TTTGTATTATTAGTACAGACAGG - Intergenic
1164475352 19:28571722-28571744 TTTGTATTTCTAGTACAGACAGG + Intergenic
1165052766 19:33152771-33152793 TCTGTATTATTAGTAGAGACGGG + Intronic
1165360783 19:35335679-35335701 TCTGTATTTCTAGTAGAGACAGG - Intronic
1165442854 19:35840505-35840527 TCTGTATTTTTAGTACAGACGGG + Intronic
1165698908 19:37922257-37922279 TGTGTTTTTTTAGTACAGACGGG + Intronic
1166582334 19:43913362-43913384 TATGTTTTACTATCTCAGATGGG - Exonic
1166970054 19:46560282-46560304 TTTGTATTTCTAGTACAGACAGG - Intronic
1167062584 19:47159116-47159138 TCTGTATTTCTAGTACAGTCAGG - Intronic
1167115377 19:47486470-47486492 TTTGTATTTCTAGCAGAGACAGG + Intergenic
1167676076 19:50886845-50886867 TTTGTTTTTTTAGTACAGACCGG - Intergenic
1167806344 19:51788790-51788812 TCTGTATTTTTAGCACAGATGGG - Intronic
1167944787 19:52979297-52979319 TCTGTATTTTTAGTACAGACAGG - Intergenic
1168024536 19:53634257-53634279 TTTGTATTTCTAGCAGAGACAGG - Intronic
1168159032 19:54496377-54496399 TTTGTATTTCTAGCAGAGACGGG - Intergenic
1168202115 19:54823206-54823228 TGTATTTTTTTAGCACAGACGGG + Intronic
1168554611 19:57327514-57327536 TTTGTATTTTTAGCACAGACGGG + Intronic
925180444 2:1813852-1813874 TTTGTATTTCTAGTACAGACGGG - Intronic
925417690 2:3682696-3682718 TTTGTATTTCTAGTACAGACGGG + Intronic
925825105 2:7840753-7840775 TCTGTATTTTTAGTACAGACGGG + Intergenic
926256119 2:11201647-11201669 TCTCATTTAATAGCACAGATAGG + Intronic
927394648 2:22636036-22636058 TCTGTATTTTTAGTACAGACAGG + Intergenic
927530966 2:23800172-23800194 CTTGTTTTACCAGCACAGAGTGG - Intronic
927643597 2:24861077-24861099 TTTGTATTTCTAGTACAGACGGG - Intronic
928423066 2:31154763-31154785 TTTGTATTATTAGTACAGACAGG + Intronic
928826416 2:35426916-35426938 TCTGTATTTTTAGCAGAGACAGG - Intergenic
929665250 2:43828792-43828814 TCTGTATTTTTAGAACAGACAGG - Intronic
929705685 2:44209602-44209624 TCTGTATTTTTAGCAGAGACGGG - Intronic
930213635 2:48670220-48670242 TTTGTTTTATTAGTAAAGACAGG - Intronic
930693048 2:54384068-54384090 TCTGTTATAGCAGCACAAACCGG + Intergenic
931076669 2:58722768-58722790 TCTGTTTGACTAGTAATGACTGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932618904 2:73254437-73254459 TCAGTTTTTCTTGCAGAGACAGG + Intergenic
933011686 2:77072624-77072646 TCTGTATACCTAGTACAGACGGG - Intronic
934031336 2:88050447-88050469 TGTGTTTTATTAGTAGAGACAGG - Intronic
934486161 2:94713335-94713357 TCTGTTTTAGAAGCACAAAATGG + Intergenic
935213493 2:100957751-100957773 TCTGTATTTTTAGCAGAGACGGG - Intronic
935448086 2:103177858-103177880 TTTGTTTTACTAGCACTGCTGGG - Intergenic
936439341 2:112537250-112537272 TCTGTATTTTTAGCAGAGACAGG + Exonic
936446070 2:112596283-112596305 TTTGTTTTTTTAGTACAGACGGG - Intergenic
936629726 2:114189118-114189140 TCCTTTCTACTAGCAGAGACTGG + Intergenic
936817492 2:116476557-116476579 TTTTTTTTTTTAGCACAGACAGG + Intergenic
937756031 2:125539981-125540003 TCTGTATTTCTAGTAGAGACAGG - Intergenic
938887494 2:135666958-135666980 TCTATTGTACAAGCACAGTCTGG + Intronic
938888704 2:135680596-135680618 TCTGTATTATTAGTAGAGACGGG - Intronic
939160614 2:138584305-138584327 TTTGTTTTTTTAGTACAGACGGG + Intergenic
939232646 2:139449860-139449882 TCTGTTTTCCTGGCAGAGAGGGG + Intergenic
939811786 2:146841825-146841847 TTTGTATTTCTAGCAGAGACAGG + Intergenic
940015582 2:149100883-149100905 TGGGTTATATTAGCACAGACAGG - Intronic
943356861 2:186867148-186867170 TTTGTTTTAGCAGCACAAACAGG - Intergenic
944137307 2:196413515-196413537 TTTGTATTTCTAGTACAGACAGG + Intronic
944655738 2:201875007-201875029 TTTGATTTCCTAGCACAGCCTGG - Intronic
945963740 2:216163459-216163481 TTTGTATTTTTAGCACAGACGGG + Intronic
946246159 2:218388627-218388649 TCTGTATTTTTAGTACAGACGGG - Intronic
946660302 2:221992357-221992379 TCTGTTTTTCCAACACAGGCTGG - Intergenic
946849400 2:223890298-223890320 TCTGTATTTCTAGTAGAGACAGG - Intronic
947072527 2:226306461-226306483 TTTGTATTTCTAGCAAAGACAGG - Intergenic
947575853 2:231273584-231273606 TCTGTATTTCTAGTAGAGACAGG + Intronic
947648885 2:231767486-231767508 TTTGTGTTTTTAGCACAGACAGG + Intronic
947981900 2:234417782-234417804 TCTGTATTTTTAGTACAGACAGG + Intergenic
948116562 2:235497767-235497789 TCTGTTTTTTTAGTAGAGACGGG + Intronic
948246675 2:236492184-236492206 TCTGTTATACCAGCACAAAATGG + Intronic
948586028 2:239020382-239020404 TCTGTTTTTCCAGCACAGTCAGG - Intergenic
1168900223 20:1357517-1357539 TTTGTATTTTTAGCACAGACGGG + Intronic
1169049531 20:2564321-2564343 TCTGTATTTTTAGTACAGACGGG + Intronic
1170136070 20:13074850-13074872 TATGTTTTAGGAGCAGAGACAGG - Intronic
1170339668 20:15310037-15310059 TGTGTTTTACTAGCATAGTATGG + Intronic
1171173228 20:23033926-23033948 TCTATTTGAGTAGCAGAGACTGG + Intergenic
1171774442 20:29352226-29352248 TCTGTTATACCAGCACAAAATGG - Intergenic
1172228442 20:33320962-33320984 TCTGTTTTACTTGCAAACACTGG - Intergenic
1173501064 20:43553871-43553893 TCTGTATTTTTAGTACAGACGGG - Intronic
1174429080 20:50455027-50455049 TATGTTTTAGTTGCACAGAAAGG + Intergenic
1174856025 20:54046354-54046376 TCTGTATTTTTAGTACAGACGGG - Intronic
1176237656 20:64061580-64061602 TTTGTATTTCTAGCAGAGACAGG + Intronic
1176627414 21:9104901-9104923 TTTGTGTTTTTAGCACAGACAGG - Intergenic
1176960170 21:15150502-15150524 TCTGTATTTTTAGTACAGACGGG + Intergenic
1177103641 21:16926313-16926335 TTTGTGCTACTAGCAAAGACAGG + Intergenic
1177148130 21:17428416-17428438 TTTGTATTTCTAGTACAGACAGG + Intergenic
1177471573 21:21566460-21566482 TCTGTTATACCAGCACAAAATGG + Intergenic
1178092965 21:29183729-29183751 TATTTTTTTCTAGCAGAGACAGG + Intergenic
1178535274 21:33404950-33404972 TATGTATTTTTAGCACAGACGGG - Intronic
1178874314 21:36401093-36401115 TCTGTATTTCTAGTAGAGACAGG - Intronic
1180227870 21:46407514-46407536 TTTGTATTTTTAGCACAGACGGG + Intronic
1180792307 22:18582226-18582248 TTTGTATTTCTAGTACAGACGGG + Intergenic
1180893220 22:19306830-19306852 TCTGTATTTTTAGCAGAGACAGG + Intergenic
1182474443 22:30568902-30568924 TCTGTATTTTTAGTACAGACGGG - Intronic
1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG + Intronic
1183162417 22:36123751-36123773 TCTGTATTTTTAGTACAGACGGG + Intergenic
1183438879 22:37811750-37811772 TTTGTATTTTTAGCACAGACAGG - Intronic
1183972167 22:41485756-41485778 TTTGTATTATTAGTACAGACCGG + Intronic
949145341 3:692736-692758 TTTGTATTTTTAGCACAGACAGG - Intergenic
949470066 3:4385055-4385077 TCTGTATTTTTAGCACAGACAGG + Intronic
950134292 3:10569865-10569887 TCTATTTGCCTAACACAGACTGG + Intronic
952874463 3:37932051-37932073 TGTGTTTTACTGGCACAAGCAGG + Intronic
954567812 3:51613593-51613615 TTTGTATTTCTACCACAGACAGG - Intronic
955100557 3:55845329-55845351 TTTGTATTATTAGCAGAGACGGG - Intronic
955322984 3:57987709-57987731 TATGTTTTTTTAGTACAGACGGG + Intergenic
956829473 3:73031366-73031388 TTTGTATTATTAGCAGAGACAGG - Intronic
957634736 3:82766265-82766287 TCTGTTATAATAGCACAAAATGG + Intergenic
958176679 3:90004137-90004159 TGTGTTTTTAAAGCACAGACAGG - Intergenic
958851501 3:99331648-99331670 TTTGTATTTCTAGTACAGACGGG + Intergenic
959677855 3:109056398-109056420 TCTGTATTTCTAGTAGAGACGGG + Intronic
960083775 3:113568959-113568981 TTTGTATTTCTAGCACAGAGGGG - Intronic
961689726 3:128660252-128660274 TTTGTTTTATTAGTAGAGACGGG - Intronic
961969889 3:130951352-130951374 TCTGTTTTACAGGCACTGAAAGG - Intronic
961979292 3:131059906-131059928 TATGCTTGACTAACACAGACAGG + Intronic
962555061 3:136540648-136540670 TTTGTATTACTAGTAGAGACAGG - Intronic
963221291 3:142815881-142815903 TCTGTTATAGCAGCACAGAACGG - Intergenic
963557433 3:146810546-146810568 TTTGTATTACTAGTAGAGACAGG + Intergenic
964139362 3:153379249-153379271 TCTGTATTTTTAGTACAGACGGG - Intergenic
965309615 3:167113033-167113055 TCTGTATTTTTAGTACAGACGGG - Intergenic
966524563 3:180906871-180906893 TTTGTATTATTAGCAGAGACGGG + Intronic
966691021 3:182741683-182741705 TTTGTATTTCTAGTACAGACAGG + Intergenic
966944513 3:184768295-184768317 TTTGTATTTTTAGCACAGACGGG - Intergenic
966976902 3:185092817-185092839 TTTGTATTTTTAGCACAGACGGG - Intronic
967056523 3:185833823-185833845 TTTGTATTATTAGCAGAGACGGG - Intergenic
967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG + Intronic
967685480 3:192411033-192411055 TATGATTTCCAAGCACAGACAGG + Intronic
967933877 3:194710853-194710875 TTTGTATTTTTAGCACAGACGGG - Intergenic
968384456 4:124127-124149 TCTGTATTTTTAGCAGAGACAGG - Intergenic
970540962 4:17078906-17078928 TCTGTCTTTCTAGTAGAGACGGG + Intergenic
971274395 4:25182251-25182273 TCTGTTTCACCATCACACACCGG - Intronic
971808751 4:31395742-31395764 TTTGTATTATTAGTACAGACAGG - Intergenic
972132401 4:35854700-35854722 TCTATTTTTTTAGTACAGACAGG - Intergenic
972587241 4:40449207-40449229 TCTTTTTTTCTATCACAGGCAGG + Intronic
972893809 4:43593851-43593873 TTTGTTTTTTTAGCAGAGACAGG - Intergenic
974846197 4:67353378-67353400 TCTGTTATAGTAGCACAAAATGG - Intergenic
974872706 4:67662632-67662654 TCTGTATTTTTAGCAGAGACAGG + Intronic
974942072 4:68481776-68481798 TTTGTATTTCTAGCAGAGACAGG - Intronic
975108072 4:70591852-70591874 TCTCTTTTACTACAACAAACAGG + Intergenic
975120375 4:70721810-70721832 ACAGTTTGACTAGCACAGTCTGG + Intronic
975366152 4:73530703-73530725 TTTGTATTTTTAGCACAGACAGG + Intergenic
975935114 4:79570257-79570279 TCTGTATTTTTAGCAGAGACGGG + Intergenic
976172048 4:82314400-82314422 TCTGTTTTAGCAGCACAAAATGG - Intergenic
976785249 4:88812192-88812214 TCTGTTTTAGTGGCACAAAATGG + Intronic
976809962 4:89090038-89090060 TCTGTCTTGCTAGCCAAGACAGG + Intronic
977119516 4:93080761-93080783 TCTGTTATAGCAGCACAGAAGGG - Intronic
977186977 4:93951027-93951049 TCTGTTATAGTAGCACAAAATGG + Intergenic
979787148 4:124730490-124730512 TTTGTATTTCTAGTACAGACGGG + Intergenic
979814405 4:125082301-125082323 TCTGTATTTTTAGTACAGACGGG - Intergenic
980118350 4:128703203-128703225 TTTGTGTTTTTAGCACAGACAGG + Intergenic
980324903 4:131330474-131330496 TTTTTTTTACTATCTCAGACTGG + Intergenic
980580035 4:134737657-134737679 TGTGTTAAACTAGCACACACTGG - Intergenic
980900034 4:138896256-138896278 TCTGTTTTAGTAGCACAAAATGG - Intergenic
982731243 4:158957596-158957618 TTTGTATTATTAGTACAGACAGG + Intronic
983210697 4:164954927-164954949 TCTGTATTTCTAGTAGAGACAGG - Intronic
983453244 4:167932141-167932163 TCTGTTTTAGCAGCACAAAATGG + Intergenic
983548771 4:168993380-168993402 TTTGTATTACTAGTAGAGACGGG + Intronic
984774752 4:183471790-183471812 TTTGTATTTTTAGCACAGACAGG - Intergenic
984792407 4:183626720-183626742 TTTGTATTACTAGTAGAGACAGG - Intergenic
985011016 4:185582133-185582155 TCTGTATTGCTAGTAGAGACAGG - Intergenic
986926981 5:12766527-12766549 TTTGTTTTTTTAGCACAGACAGG - Intergenic
988241481 5:28614768-28614790 TCTGTTATAGCAGCACAAACAGG + Intergenic
988477642 5:31601482-31601504 TCTGTATTTTTAGCAGAGACAGG - Intergenic
989815778 5:45735902-45735924 TTTATTTTAGGAGCACAGACTGG - Intergenic
990147622 5:52780670-52780692 TTTGTATTTCTAGTACAGACAGG + Intergenic
990261927 5:54032404-54032426 TTTGTATTTTTAGCACAGACAGG + Intronic
990465516 5:56067809-56067831 TTTGTATTTTTAGCACAGACGGG + Intergenic
991681092 5:69140190-69140212 TTTGTATTACTAGTAGAGACAGG + Intergenic
991921074 5:71657596-71657618 TCTGTATTTTTAGCAGAGACGGG + Exonic
992457846 5:76932523-76932545 TTTGTTTTTCTAGCAGAGATGGG + Intergenic
992751340 5:79865528-79865550 TCTGTATTTCTAGTAGAGACGGG + Intergenic
993277113 5:85874240-85874262 TCTGTTGTAGCAGCACAAACAGG - Intergenic
993670706 5:90758157-90758179 TTTGTATTTCTAGTACAGACGGG - Intronic
994164245 5:96592225-96592247 CCTGTATTTCTAGCAGAGACAGG - Intronic
994193659 5:96898022-96898044 TTTGTATTTCTAGTACAGACGGG - Intronic
995243781 5:109914832-109914854 TCTCTTTTCCTAGAACAGCCTGG + Intergenic
995257005 5:110058385-110058407 TCTCTATTAGTAGCACAGATTGG + Intergenic
995595239 5:113741213-113741235 TCTGATTCAGTAACACAGACAGG + Intergenic
996777811 5:127151909-127151931 TCTGTTTTACCAACACAAAATGG - Intergenic
998057624 5:139092436-139092458 TCTGTTTTACTTGCAAAAAGAGG + Intronic
998454742 5:142263050-142263072 TTTGTATTTGTAGCACAGACCGG + Intergenic
998541254 5:142983375-142983397 TTTGTATTACTAGTAGAGACAGG + Intronic
998924518 5:147107091-147107113 TCTGTTATAGTAGCACAAAACGG + Intergenic
1000063514 5:157676242-157676264 TTTGTTTTATTAGTAGAGACGGG + Intronic
1000797691 5:165685614-165685636 TTTGTTTTTTTAGCAGAGACAGG + Intergenic
1002589411 5:180279127-180279149 TCTGTATTTTTAGCAAAGACGGG + Intronic
1003592984 6:7451256-7451278 TTTGTATTTTTAGCACAGACAGG + Intergenic
1003784203 6:9465701-9465723 TCTGTTGTACTAACAGAGACTGG + Intergenic
1003790043 6:9536036-9536058 TTTGTGTTACTAGTAGAGACGGG + Intergenic
1003875477 6:10432568-10432590 TTTGTATTATTAGTACAGACAGG + Intergenic
1003948636 6:11097482-11097504 TTTTTTTTTTTAGCACAGACGGG - Intronic
1004360185 6:14964070-14964092 TTTGTATTACTAGTAGAGACGGG - Intergenic
1004399347 6:15274099-15274121 TCTGTATTTTTAGTACAGACGGG + Intronic
1004844714 6:19626833-19626855 TTTGTTTTTCTAGTAGAGACAGG - Intergenic
1004920269 6:20369573-20369595 TTTGTATTAATAGCAGAGACGGG - Intergenic
1005030464 6:21503867-21503889 TCTGTTTTTCTAGAAAAGATGGG + Intergenic
1005371881 6:25141993-25142015 TTTGTATTTCTAGTACAGACAGG - Intergenic
1005622055 6:27629216-27629238 TTTGTATTTTTAGCACAGACGGG - Intergenic
1006988031 6:38189843-38189865 TTTGTATTTTTAGCACAGACGGG + Intronic
1007449005 6:41929071-41929093 TTTGTTTTATTAGTAGAGACAGG + Intronic
1007898347 6:45385726-45385748 TCTGTATTTTTAGTACAGACGGG - Intronic
1008005271 6:46403399-46403421 TTTGTTTTTTTAGCAGAGACAGG - Intronic
1008239394 6:49090394-49090416 TCTGTATTTCTAGTAGAGACGGG + Intergenic
1009399510 6:63237710-63237732 TCTGTTATAGCAGCACAGAATGG - Intergenic
1010330721 6:74620658-74620680 TTTGTATTTTTAGCACAGACAGG - Intergenic
1010705890 6:79110240-79110262 TTTGTTTTTTTAGTACAGACGGG - Intergenic
1012803874 6:103870020-103870042 TCTGTTTTACTTGCATAGTATGG + Intergenic
1012805024 6:103883006-103883028 TCTGTGCTAGTGGCACAGACTGG - Intergenic
1013041526 6:106438701-106438723 TCTGTTTTACTAGTAGAAAAAGG - Intergenic
1014270220 6:119327968-119327990 TCTGTTTTACAAGCTCATTCAGG - Intronic
1016413471 6:143808298-143808320 TTTGTATTAATAGCAGAGACAGG + Intronic
1017023996 6:150165990-150166012 TCTGGTGTACTGGCACTGACTGG - Intronic
1017063200 6:150506046-150506068 TCAGTTGTACTAGCAAATACTGG - Intergenic
1018037846 6:159897045-159897067 TCTGTATTTCTAGTAGAGACGGG + Intergenic
1018227087 6:161638911-161638933 TCTGTATTTTTAGTACAGACGGG + Intronic
1018306224 6:162458990-162459012 TTTGTTTTTTTAGTACAGACGGG + Intronic
1018549533 6:164979365-164979387 TCTGTTATAATAGCACAAAATGG + Intergenic
1019679803 7:2340683-2340705 TCTGTATTATTAGCAGAGATGGG - Intronic
1019984807 7:4647906-4647928 TTTGTATTATTAGTACAGACGGG - Intergenic
1021215631 7:17912580-17912602 TCTGTATTTCTAGTAGAGACGGG + Intronic
1023285215 7:38612245-38612267 TCTGTATTTTTAGTACAGACGGG + Intronic
1025703918 7:63845144-63845166 TCTGTATTTTTAGTACAGACAGG + Intergenic
1025937123 7:66046353-66046375 TTTGTTTTTTTAGCAGAGACGGG - Intergenic
1026041919 7:66875264-66875286 TTTGTATTTCTAGTACAGACAGG + Intergenic
1026216828 7:68356955-68356977 TTTGTATTATTAGCAGAGACGGG - Intergenic
1026571784 7:71537638-71537660 TTTGTATTTTTAGCACAGACAGG - Intronic
1027749233 7:82120701-82120723 TTTGTATTATTAGTACAGACAGG - Intronic
1027913824 7:84288524-84288546 TCTGTGTTTTTAGTACAGACAGG - Intronic
1029297260 7:99551366-99551388 TCTGTATTTCTAGTAGAGACAGG + Intronic
1029513955 7:101014283-101014305 TCTGTTATAATAGCACAAAATGG - Intronic
1029800365 7:102940381-102940403 TCTGTATTTTTAGCAGAGACAGG + Intronic
1031870937 7:127089693-127089715 TTTGTTTTACTGTCTCAGACAGG - Intronic
1032162190 7:129519467-129519489 TTTGTATTTTTAGCACAGACGGG + Intergenic
1032951708 7:136921936-136921958 TTTGTATTTCTAGTACAGACAGG + Intronic
1033139222 7:138809993-138810015 TCTTTCCTACTAACACAGACAGG + Intronic
1033404652 7:141061005-141061027 TTTGTATTTTTAGCACAGACAGG - Intergenic
1034512786 7:151549938-151549960 TCTGTTATAGCAGCACAGAATGG + Intergenic
1035200088 7:157257561-157257583 TCTGTATTTTTAGCAAAGACAGG - Intronic
1036172537 8:6503257-6503279 TGTGTTTTACTTTCACAGGCTGG - Exonic
1037523616 8:19703474-19703496 TCTGTATTTTTAGTACAGACAGG + Intronic
1037567767 8:20131934-20131956 TATTTTTTTTTAGCACAGACGGG + Intergenic
1038260793 8:25992165-25992187 TCTGTATTTTTAGCAGAGACAGG - Intronic
1038623149 8:29164179-29164201 GATGTTATATTAGCACAGACTGG - Intronic
1039059413 8:33561712-33561734 TTTGTATTTCTAGTACAGACTGG + Intronic
1039520849 8:38170209-38170231 TCTGTATTTTTAGCAGAGACAGG + Intronic
1040475024 8:47768527-47768549 TTTGTATTATTAGCAGAGACAGG - Intergenic
1040949066 8:52917647-52917669 TCTATTTTTTTAGTACAGACGGG - Intergenic
1041227041 8:55711115-55711137 TCTGTATTTTTAGCAGAGACAGG - Intronic
1041417390 8:57626643-57626665 TCTGTCTTCCTAGTACAGAGGGG + Intergenic
1042682749 8:71404743-71404765 TTTGTATTACTAGTAGAGACGGG - Exonic
1042733510 8:71962826-71962848 TGTGTTTTACTTGCTCAGATGGG - Intronic
1043062859 8:75526947-75526969 TTTGTATTTTTAGCACAGACGGG + Intronic
1044884035 8:96757174-96757196 TTTGTATTTCTAGCACAGACGGG - Intronic
1044989306 8:97781447-97781469 TTTGTTTTCCTAGTAGAGACAGG + Intronic
1046200274 8:110918184-110918206 TCTGTTTTACATGCAAACACTGG + Intergenic
1046749879 8:117915681-117915703 TCTGTATTTTTAGCAGAGACAGG - Intronic
1047621791 8:126615225-126615247 TCTGTTATAGTAGCACAAAATGG + Intergenic
1048885693 8:138907644-138907666 TCTCTTTTAATAATACAGACTGG + Intronic
1050079402 9:1900126-1900148 TCTGTGTTTTTAGCAAAGACGGG - Intergenic
1050249447 9:3729104-3729126 TCTGTATTTTTAGCAGAGACGGG + Intergenic
1050254336 9:3778476-3778498 TCTGTTTTACTCACACAGACTGG + Intergenic
1050349638 9:4728397-4728419 TTTGTATTACTAGTAGAGACAGG - Intronic
1052733328 9:32315088-32315110 CCTGTTGTACTAGCAAATACTGG - Intergenic
1053241863 9:36502412-36502434 TCTGTTTTTTAAGTACAGACTGG + Intergenic
1053671635 9:40370991-40371013 TCTGTTTTAGAAGCACAAAATGG - Intergenic
1053921446 9:42997360-42997382 TCTGTTTTAGAAGCACAAAATGG - Intergenic
1054382749 9:64511035-64511057 TCTGTTTTAGAAGCACAAAATGG - Intergenic
1054512983 9:66005319-66005341 TCTGTTTTAGAAGCACAAAATGG + Intergenic
1054929090 9:70617791-70617813 TTTGTATTTCTAGTACAGACGGG - Intronic
1055005425 9:71500049-71500071 TCTGTATTTTTAGTACAGACGGG + Intergenic
1055466308 9:76570206-76570228 TTTGTTTTATTAGTACAGATGGG + Intergenic
1055791511 9:79927599-79927621 TTTGTATTATTAGCAGAGACAGG - Intergenic
1056558676 9:87710835-87710857 TTTGTATTTTTAGCACAGACAGG - Intergenic
1056594763 9:87997914-87997936 TCTGTTATAGCAGCACAGAAGGG + Intergenic
1056720789 9:89069974-89069996 TGTGTTTTACTAGCACAAGTAGG - Intronic
1058947631 9:109873676-109873698 TCTTTTTTACTTGCACATTCTGG - Intronic
1060428045 9:123522937-123522959 TCTGTATTCCTAGCACATAGTGG - Intronic
1060656441 9:125375530-125375552 TCTGTGTTTCTAGTAGAGACAGG - Intergenic
1060950890 9:127601981-127602003 TCTGTTTTAGCAGCACAAAATGG + Intergenic
1061334928 9:129926713-129926735 TCTGTATTTTTAGCAGAGACGGG - Intronic
1061476290 9:130868992-130869014 TCTGTATTATTAGTAGAGACGGG - Intronic
1185564952 X:1088031-1088053 TTTGTATTTCTAGTACAGACAGG + Intergenic
1185692015 X:2163156-2163178 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1185783401 X:2868334-2868356 TTTGTATTTCTAGCAGAGACAGG - Intronic
1186304446 X:8240599-8240621 TGTGTTTTACTAGCTCAATCAGG + Intergenic
1186366929 X:8905294-8905316 TCTGCTGTTCTAGCAGAGACTGG - Intergenic
1186399772 X:9246739-9246761 TTTGTATTTTTAGCACAGACGGG + Intergenic
1186755633 X:12668774-12668796 TTTGTATTATTAGTACAGACAGG + Intronic
1187340370 X:18415692-18415714 ACTGTTATACTAGCACAATCTGG + Intergenic
1187917165 X:24164758-24164780 TATTTTTTACTAGTAGAGACAGG - Intronic
1188082057 X:25855233-25855255 TCTGTTATAGCAGCACAGAATGG + Intergenic
1189644977 X:43118399-43118421 TCTGTATTTTTAGCAGAGACAGG + Intergenic
1190291122 X:48992991-48993013 TCTGTATTTCTAGTAGAGACGGG + Intronic
1191127090 X:56968439-56968461 TTTGTATTTCTAGCAGAGACGGG - Intergenic
1191897003 X:66003223-66003245 TCTGTATTTTTAGTACAGACGGG - Intergenic
1193307338 X:79964561-79964583 TCTGTATTATTAGTAGAGACGGG + Intergenic
1193571452 X:83149924-83149946 TCTGTTTTACTCCCACAGAAGGG + Intergenic
1193904949 X:87230926-87230948 TCTGTATTATTAGTAGAGACGGG - Intergenic
1195315154 X:103670161-103670183 TCTGTTATAGTAGCACAAAATGG + Intergenic
1196739533 X:119012432-119012454 TCTGTTATAGTAGCACAAAATGG - Intronic
1197014990 X:121613702-121613724 TCTATTATAGTAGCACAGAATGG + Intergenic
1197745127 X:129927676-129927698 TTTGTATTATTAGCAGAGACAGG + Intronic
1198348945 X:135786090-135786112 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1198352757 X:135820627-135820649 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1198354666 X:135837895-135837917 TCTGTATTTTTAGCAGAGACGGG - Intergenic
1198375156 X:136031526-136031548 TCTGTATTTTTAGCAGAGACAGG - Intronic
1198460825 X:136861499-136861521 TTTGTATTTTTAGCACAGACGGG - Intronic
1198862947 X:141090208-141090230 TCTGTATTTTTAGTACAGACGGG - Intergenic
1198895945 X:141454620-141454642 TCTGTATTCTTAGTACAGACGGG - Intergenic
1198899745 X:141497179-141497201 TCTGTATTTTTAGTACAGACGGG + Intergenic
1199342622 X:146699112-146699134 TCTGTTTTAGGATCACATACAGG - Intergenic
1199461157 X:148087041-148087063 TCTGTTGTACCAGCACAAAATGG - Intergenic
1200845273 Y:7826106-7826128 TCTGTTCCTCTGGCACAGACAGG + Intergenic
1200897804 Y:8394480-8394502 TCTGTTGCACTGGCACAGGCAGG + Intergenic