ID: 1153482306

View in Genome Browser
Species Human (GRCh38)
Location 18:5559267-5559289
Sequence CTTTACAAATAAATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153482306 Original CRISPR CTTTACAAATAAATGGAGGA GGG Intronic
901117423 1:6858915-6858937 CTTTACATATTAATGAAGAAAGG + Intronic
903520778 1:23947282-23947304 CCTTTCAAAAAAATGGAAGAAGG - Intergenic
903524919 1:23986415-23986437 CATTTCAAATCAATGGAGAAGGG - Intergenic
904242979 1:29162534-29162556 CTTGACAATTAAATTCAGGAGGG - Intronic
904250314 1:29218781-29218803 ATTTACACATAGCTGGAGGACGG + Intronic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
909218185 1:72919246-72919268 CTTTACAAATAAATATAGAGGGG - Intergenic
909331350 1:74415348-74415370 TTTAACAAATAAATGAATGATGG - Intronic
909394874 1:75159223-75159245 CTTTACCAATAAATGGGGCCAGG - Intronic
909682037 1:78302717-78302739 TTTGACAAATAAATGAAGGACGG - Intergenic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
913055808 1:115158655-115158677 TTTTACTATTAAGTGGAGGAAGG + Intergenic
916779266 1:168007452-168007474 GTTAATAAATAAATGAAGGATGG - Intronic
917013624 1:170503973-170503995 CTTTTCTAGTAAATGAAGGAAGG + Intergenic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917234958 1:172881965-172881987 CCTTACAATTCAATGGAGGAGGG + Intergenic
917393264 1:174562697-174562719 CTTTGCAAGTACATGGATGAAGG + Intronic
919064887 1:192682282-192682304 CCTTACAAACAAAGGGAGTATGG + Intergenic
919221542 1:194636437-194636459 ATTTAAAAATAAATACAGGAAGG - Intergenic
919383537 1:196889710-196889732 TTTTACAAATAAATTTTGGAGGG - Intronic
920016945 1:202919496-202919518 TTTAAAAAAAAAATGGAGGAAGG - Intronic
920895110 1:210040594-210040616 CCTTATAAATAAATGGACGTAGG + Intronic
921544573 1:216459297-216459319 TTTTCCAAAGAAAAGGAGGAAGG - Intergenic
921585442 1:216941037-216941059 CTTTACACATAAAACTAGGATGG + Intronic
921746465 1:218745845-218745867 CTTCACAAAAAAAGGCAGGAAGG + Intergenic
922311465 1:224396024-224396046 CCTTACAAATAAATGGCAAATGG + Intronic
922909176 1:229201083-229201105 CATGACAAATGAATGTAGGAGGG - Intergenic
924385751 1:243496796-243496818 CTTTAGAAATAAATGAGGCAGGG + Intronic
1063813337 10:9740529-9740551 CTTGACAAATATATGGACCATGG + Intergenic
1065224416 10:23528334-23528356 CCTTAGATATAAATGGAGGCAGG + Intergenic
1065805833 10:29393040-29393062 CTTTATAATTAAAAGCAGGATGG - Intergenic
1066368742 10:34801254-34801276 GTTTACAAATAAATACAGGAAGG + Intronic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067975414 10:51019404-51019426 CTTTTCAAACAAATGGTGGTAGG + Intronic
1068236383 10:54239167-54239189 CTATAGAAATAAATAGATGAAGG - Intronic
1068359670 10:55960668-55960690 AGTTACAAAAAAATGCAGGATGG + Intergenic
1070109527 10:73470556-73470578 CTTTATAAATAACTGTAAGATGG - Intronic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1070958902 10:80485390-80485412 ATTTACACAAAAATGCAGGAAGG - Intronic
1071084475 10:81852847-81852869 CTTGAAAAATAAATAAAGGAGGG - Intergenic
1071808977 10:89157373-89157395 CTTTAAAAATAAATAGAGTCAGG + Intergenic
1071892548 10:90027128-90027150 CTTAAAAAATAAATGCATGAAGG + Intergenic
1072123588 10:92425961-92425983 ATATATAAATAAATGGAGAATGG - Intergenic
1073166658 10:101460372-101460394 ATCTACCAAAAAATGGAGGAAGG - Intronic
1073198408 10:101714597-101714619 CTTTTCAAATAAATGGTGGTGGG - Intergenic
1073590477 10:104752579-104752601 CTTCTCAAATAAATGGAAGAGGG - Intronic
1073804390 10:107081201-107081223 CTTTACAACTCAATGGATAATGG + Intronic
1073944359 10:108732584-108732606 CTTTTCAAATTAATTGAGCAAGG - Intergenic
1074046642 10:109845448-109845470 CTTTAAAAATAACTTGTGGAGGG + Intergenic
1074061437 10:109969700-109969722 CTTCACAAATGAATGAATGATGG + Intergenic
1074672067 10:115802377-115802399 CTTTTCAAATAAAAGTATGATGG - Intronic
1075340204 10:121641428-121641450 TTTTACAAATAAATGGCAAAGGG + Intergenic
1075678342 10:124313446-124313468 CTTTGCAAATCAAAGGAAGAGGG + Intergenic
1077418108 11:2435310-2435332 CTGTGCAAATAACTGGACGAAGG + Intergenic
1078415753 11:11163299-11163321 CTTTCCAAATCCAAGGAGGAAGG - Intergenic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1078688200 11:13552418-13552440 CTTTAAAAACAAGTGAAGGAGGG + Intergenic
1079898505 11:26151265-26151287 ATTGGCAAATAAATGGATGAAGG + Intergenic
1080412519 11:32039073-32039095 CTTTGCAAACAAATAGAAGAGGG - Intronic
1083032188 11:59603278-59603300 CTTAATAAATAAATAAAGGAAGG + Intronic
1084356545 11:68642294-68642316 CATTAGATATAAATGGAGGCCGG + Intergenic
1085144200 11:74178221-74178243 CTTTACAAATAAAAAGAAGCGGG + Intronic
1085706586 11:78791886-78791908 CTTTCTGAATTAATGGAGGAGGG + Intronic
1086428513 11:86712425-86712447 CTTTAAAAATAAATGAATGCTGG - Intergenic
1087917785 11:103830887-103830909 CATTGAAAATGAATGGAGGAAGG + Intergenic
1088647176 11:111926706-111926728 CTTAACAGACAAATGGGGGAAGG + Exonic
1090118313 11:123998435-123998457 CTTTACAAATACCTGGAGAGGGG - Intergenic
1090353797 11:126125561-126125583 CTTTACAAATAAATGAACTGAGG + Intergenic
1091482781 12:851258-851280 CTTTCAAAATGATTGGAGGAAGG + Intronic
1091486174 12:891117-891139 CTTTTCAAATCATTGGAAGATGG + Intronic
1092379993 12:7987935-7987957 ATTCACAAAGAAATGGAGGCTGG - Intergenic
1092559564 12:9596858-9596880 ATTTACAAATAAATGAAAGTAGG - Intronic
1093078854 12:14786784-14786806 ATTTCCAAAGAACTGGAGGAGGG + Exonic
1094711248 12:32964861-32964883 CTTTAGGAAAACATGGAGGAGGG - Intergenic
1097676819 12:62611886-62611908 GTTTAAAAATAAATAGAGGCAGG + Intergenic
1097736095 12:63182744-63182766 ATGTGCAAATGAATGGAGGAGGG + Intergenic
1097852385 12:64425593-64425615 CATTTAAAAGAAATGGAGGAGGG - Intronic
1099017281 12:77359042-77359064 CTCTACAAATAAATAAAGAAAGG - Intergenic
1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG + Intronic
1099243222 12:80163030-80163052 CTTTCCAAAAAAATGGAGCCTGG + Intergenic
1100056788 12:90521578-90521600 ATTTAGAAATGAATGGAAGAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101609812 12:106280183-106280205 CTTTAAAAATAAATGGGGTAAGG + Intronic
1101687385 12:107038480-107038502 CTTATAAAAGAAATGGAGGAAGG + Intronic
1102186823 12:110955313-110955335 CATTTCAAACAAATGAAGGAAGG + Intergenic
1103487377 12:121292427-121292449 CTTTTTAAAAAAATTGAGGAGGG - Intronic
1103843600 12:123885817-123885839 CTTTACTATTAATTGGAGAAAGG - Intronic
1104201858 12:126597544-126597566 CCTCACAATTAAATGAAGGATGG + Intergenic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1105299849 13:19123368-19123390 CACTACAAATAAATACAGGAAGG - Intergenic
1106968652 13:35106761-35106783 CTTTAAAAAAAAAAGGCGGAGGG - Intronic
1107089041 13:36456636-36456658 CTTAACAAATTTAGGGAGGAAGG + Intergenic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1108109578 13:47054462-47054484 AGTGACAAATAAATGGAGGTCGG - Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1109196637 13:59384730-59384752 CTTTACAAATAGAAGTGGGAAGG - Intergenic
1109684609 13:65800625-65800647 TTTTACAAATAAATAATGGATGG + Intergenic
1111029185 13:82573600-82573622 CTTTGCAAAAACATGGATGAAGG - Intergenic
1111043341 13:82780979-82781001 TTTTGGAAAGAAATGGAGGAGGG - Intergenic
1113202798 13:107885817-107885839 CTCTACAAAGAAATGGAGAATGG + Intergenic
1113806518 13:113113214-113113236 CTTTCCAGACAAATTGAGGATGG + Intronic
1114229829 14:20770682-20770704 ATTGACAAATAAATGCAAGAGGG - Exonic
1115311240 14:31980490-31980512 CTATACCAAAAAATGGAGAAGGG - Intergenic
1115923137 14:38400314-38400336 TTTTACAAGAAAATGGAGAAAGG + Intergenic
1116348658 14:43830013-43830035 CTTTTCTAAAAAATTGAGGAGGG - Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116750379 14:48875796-48875818 CTTTCCAAATCAGTGGAGGTAGG + Intergenic
1118127041 14:62917300-62917322 CTTTAAAGATAAATTGAGTAGGG - Intronic
1118185073 14:63530125-63530147 CTTTACATATAATTTTAGGAGGG + Intronic
1118542002 14:66838324-66838346 CTTTAAAAATAAGTAGATGATGG + Intronic
1118599259 14:67460156-67460178 CTTTACAAAAAAAGGGAGGCGGG - Intronic
1119913235 14:78370717-78370739 CTTTACATATAAGAAGAGGAAGG + Intronic
1121882627 14:97514469-97514491 GTTAACAAGTAAATGAAGGAAGG - Intergenic
1125599002 15:40905535-40905557 CTTTAAAAAAAAAAGGCGGAGGG - Intergenic
1125652572 15:41329612-41329634 CTTTGTAAAAAACTGGAGGAAGG - Intronic
1125978489 15:43977733-43977755 CTTTACAAATAAATCTAGATTGG - Intronic
1126648953 15:50902691-50902713 CTTTAAACAGAAAAGGAGGAGGG - Intergenic
1127359716 15:58234635-58234657 CTTTAAAAAGAAATGTAGGCTGG + Intronic
1127407901 15:58672042-58672064 TTTTACAAATAAATTGAGTAAGG - Intronic
1128447963 15:67781514-67781536 CTTGAAAATTAAATAGAGGACGG - Intronic
1128716149 15:69909581-69909603 CTTTACAAATAAAAGTGGGGAGG + Intergenic
1129864234 15:78891254-78891276 ATTTATAAATAAATGGAAGATGG + Intronic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1131211879 15:90504632-90504654 CTTTAAAAATGAATGAAGGTGGG - Intergenic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134781940 16:16906111-16906133 CGTTACAAATATATGTGGGATGG + Intergenic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1138352257 16:56352288-56352310 CTTTCCAAATGGATGGATGAGGG + Intronic
1138634482 16:58326404-58326426 CTTTTCAATTAAATGGAAAAAGG + Intronic
1138718527 16:59051847-59051869 ATTTACAAATAAATAAAGAAAGG - Intergenic
1138862176 16:60771792-60771814 CTTTACAAATAATGTGAAGAAGG + Intergenic
1139046970 16:63073158-63073180 CTTTTCAAAAAAATTGAGGAGGG - Intergenic
1139371013 16:66469492-66469514 CTCCCTAAATAAATGGAGGAGGG - Intronic
1139724316 16:68884208-68884230 CTTTACAAATAAAGTGAGTGAGG - Intronic
1140902588 16:79383406-79383428 GTTTAAAAAAAAATGAAGGATGG + Intergenic
1143313595 17:6014054-6014076 CTTTAGGAATAAAAGGAGCAAGG + Intronic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1149187060 17:54010860-54010882 CTTTACACATAAGTGAAGGAAGG - Intergenic
1149421818 17:56519057-56519079 CTTTACAAATAAAAAGAGTGAGG + Intergenic
1150547855 17:66180224-66180246 CTATTCAAAAAAATAGAGGAGGG - Intronic
1150597752 17:66621903-66621925 CTTTAAAAATAAGTTGAGGCTGG + Intronic
1150898252 17:69238875-69238897 CTTTACAATTAAATCAATGATGG - Intronic
1151365594 17:73614266-73614288 CTTTACAGTTAAGTGCAGGAAGG + Intronic
1153209263 18:2741953-2741975 TTTTACTATAAAATGGAGGAGGG - Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1155097154 18:22567929-22567951 CTTGACAAATACATGGAGTCAGG + Intergenic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1155790050 18:29954961-29954983 CTCCACAGAAAAATGGAGGATGG - Intergenic
1156723991 18:40105431-40105453 CTGGACAAATAAATGATGGAGGG + Intergenic
1157089935 18:44625481-44625503 CTTTACATATAAATAAAGGGAGG - Intergenic
1157289985 18:46402801-46402823 GTTCACAAATAAAAGGAGAATGG - Intronic
1157429267 18:47611204-47611226 CTTAAAAAATATCTGGAGGATGG - Intergenic
1157839657 18:50944823-50944845 ATTTATAAATAAATGAATGAAGG - Intronic
1158079553 18:53573697-53573719 CTTTAGAAATAAAAGTAGGCTGG - Intergenic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158163025 18:54507489-54507511 CTTGACAAATTATTGGAGAAGGG + Intergenic
1158813524 18:61066397-61066419 CTTTACAATTATATGGATCAGGG - Intergenic
1159008507 18:63035883-63035905 CTTTCCAAATAAGTGGAGGTGGG + Intergenic
1159408994 18:68044920-68044942 ATTTAAAAATAAATGGAAGGAGG + Intergenic
1159578703 18:70210362-70210384 CTGCACAAATAAATGCAGTAAGG - Intergenic
1159745162 18:72225033-72225055 TTTTACAAATAAATATAAGATGG + Intergenic
1159964014 18:74578761-74578783 GTTTACACATAGATGGAGTAGGG + Intronic
1160200318 18:76790394-76790416 TATTACAAATAAATTGAGGCTGG + Intergenic
1162202946 19:9034479-9034501 TTTTAAAAATAATTGAAGGAGGG + Intergenic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1163090422 19:15015696-15015718 CTATATAAATGAATGAAGGAAGG + Intronic
1163922797 19:20308746-20308768 GTTTCCAAGTAAATGAAGGAGGG + Intergenic
1163973006 19:20818550-20818572 GTTTCCAAGTAAATGAAGGATGG + Intronic
1164655439 19:29917787-29917809 CTTTACATATAACAGGAGGAAGG + Intergenic
1167717336 19:51152247-51152269 CCTTACAAGTGAAAGGAGGAGGG - Intronic
1167835343 19:52063897-52063919 CTTTACAAATGAAATGAGGGTGG - Intronic
1168483728 19:56742917-56742939 CTTTACCTGTAAGTGGAGGATGG + Intergenic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928531390 2:32196016-32196038 CTTTAAAAAAAAATGAAGGCTGG + Intronic
928703788 2:33926133-33926155 CTATACAAATAGGTGAAGGAGGG + Intergenic
929762959 2:44821143-44821165 CTTTGCAAATAAACCGATGAAGG + Intergenic
930235184 2:48882450-48882472 CTTTACTAAGAAATGAATGATGG - Intergenic
930592347 2:53343038-53343060 CTATTCAAAAAAATTGAGGAGGG - Intergenic
930971425 2:57399117-57399139 CTTTTGAAAATAATGGAGGAAGG - Intergenic
931037101 2:58255822-58255844 GTTAAAAAATAAATGGAAGAAGG - Intergenic
931883768 2:66593577-66593599 CTATTCAAATAAATGTAGTACGG - Intergenic
932032507 2:68205033-68205055 CTTTTTAAATAAATGGAAAAGGG - Intronic
932959818 2:76399485-76399507 CGTTGCAAATAAATGGTGCATGG + Intergenic
933317458 2:80732886-80732908 ATTTAGAAATCAATGAAGGAAGG + Intergenic
935563120 2:104578677-104578699 CTTAACAGTTAATTGGAGGAAGG + Intergenic
935701249 2:105813885-105813907 CTTTAGAAATAAAGGAGGGAGGG - Intronic
937778318 2:125807825-125807847 GTTTACAGATAAATAGAGGCAGG + Intergenic
938058675 2:128235591-128235613 CTTTCAAAATAAATGTATGATGG + Intergenic
939417084 2:141913745-141913767 CTTAAAAAAAAAATGTAGGAGGG - Intronic
941174584 2:162180976-162180998 CTTAAATAATAAATGGAGGCCGG + Intronic
942084372 2:172429845-172429867 CTTTACAAAAGCATGGAGGTGGG - Intronic
942413193 2:175732985-175733007 CTTTACAAATGAAGAAAGGAAGG + Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944506763 2:200420426-200420448 CTTTGCAATTAAATGAAGTAAGG + Intronic
944913735 2:204336162-204336184 CTTTCCAAATAAATGAGGGTGGG - Intergenic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
945172273 2:207009125-207009147 CTTAGCAAATTAATGGAGGGAGG - Intergenic
945304801 2:208249047-208249069 CTTTAAAAATAAAAGGGGGTGGG + Intronic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
946136244 2:217649630-217649652 CATTTCAAATAACTGGAGAAGGG + Intronic
946603421 2:221375611-221375633 CTTTACAAAACAAAGAAGGAAGG - Intergenic
1169032274 20:2418778-2418800 CTTTAAAAATATATTGAGGCCGG + Intronic
1169507470 20:6227513-6227535 TTTTAAAAATAAATGGTGGAGGG + Intergenic
1170165334 20:13356115-13356137 CTTAACAAAAAAATAGAGAAAGG + Intergenic
1170203537 20:13770999-13771021 TTTTAAAAATGCATGGAGGAAGG - Intronic
1170209500 20:13834573-13834595 CATTTCAAATCAATGGAGAAGGG - Intergenic
1170255606 20:14339714-14339736 CTTGACAAATAAAGGCAGCAAGG + Intronic
1170340241 20:15318427-15318449 CTTTTCCAAAAAATGGAAGAGGG + Intronic
1170519664 20:17171285-17171307 CATTGCAAATCTATGGAGGAAGG - Intergenic
1170917690 20:20643644-20643666 TTTTAAAAATAAAAGGAAGAAGG + Intronic
1174145327 20:48449230-48449252 CTTTAAAACTAAGTGGGGGAAGG + Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1178290381 21:31362950-31362972 CATTACAAATAAAGGGGGAAAGG - Intronic
1178399167 21:32268982-32269004 TTTAACAAATAAGGGGAGGAAGG + Exonic
1182766530 22:32761731-32761753 GTAAATAAATAAATGGAGGAAGG - Intronic
1183255817 22:36761280-36761302 TTTCACAAATGAATGGAGGAAGG + Intronic
1183551892 22:38492987-38493009 CTTTATTAATAAAGGGAGGGTGG + Intronic
1185114760 22:48926375-48926397 CATTACCAACAAGTGGAGGAGGG - Intergenic
951585955 3:24214766-24214788 CTTTACAAATGAGATGAGGAGGG - Intronic
951988938 3:28653959-28653981 CTTTACAAAGAAATAGAGGAAGG - Intergenic
952350592 3:32532900-32532922 CTTTAAAATTAAATGTAGAAAGG - Intronic
952944769 3:38471908-38471930 GCTTACAAATATATGGATGAAGG + Intronic
953154248 3:40354414-40354436 CTTTCCAAAATAATAGAGGAAGG - Intergenic
954363736 3:50135584-50135606 CTTAAAAAAGAAGTGGAGGAAGG + Intergenic
955614333 3:60790264-60790286 ATTTACAAATCAGTGAAGGAAGG + Intronic
956151447 3:66247311-66247333 ATTTACAAATGAATGAATGATGG + Intronic
956266505 3:67402576-67402598 GTTTCCAAATAACTGTAGGATGG + Intronic
957338577 3:78863386-78863408 TTTTACAACTAAGTGCAGGAAGG + Intronic
957386878 3:79507339-79507361 CATTAGAAATAAATGGGGGCAGG + Intronic
959068675 3:101682602-101682624 GCCTACAAATAAATGGAGGTAGG - Intronic
959549284 3:107636324-107636346 CTTTACCAAGGAATGGAGGTGGG + Intronic
960827423 3:121805065-121805087 CTTTTTAAATATATGGAGTATGG + Intronic
961925556 3:130475975-130475997 CTTTACCAACATCTGGAGGAAGG + Intronic
962015544 3:131436181-131436203 CTCAAAAAATAAGTGGAGGAAGG + Intergenic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963787433 3:149549053-149549075 TTAAACAAATAAATGGATGAAGG + Intronic
964360602 3:155891965-155891987 TTTTGCAGATAAATGGAGAAGGG + Intronic
965146900 3:164916405-164916427 TTTTACAAATTAAAGGTGGATGG - Intergenic
965664610 3:171079712-171079734 AATTAGAAATAAATGGAGGTGGG - Intronic
968136143 3:196220847-196220869 GTTTACAAATGAAGCGAGGAAGG - Intronic
970319149 4:14858596-14858618 AATTACTAATAAATGAAGGAAGG + Intergenic
972047480 4:34685424-34685446 TTCTACAAATAAATGAAAGAAGG - Intergenic
972462504 4:39317858-39317880 CTATACAAAGAAATGGCGGCCGG + Intronic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
974439446 4:61898081-61898103 CTTGACAGGTAAATGGAGGGTGG - Intronic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
974783718 4:66589636-66589658 CATTAGAAATAGATGGAGTAGGG + Intergenic
975630392 4:76395891-76395913 CTTTACAAAGCAATGGTAGAGGG - Intronic
976082478 4:81371148-81371170 CTATTCAAAAAAATAGAGGAGGG - Intergenic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977894199 4:102345502-102345524 CTTTACAAATAAGGGGAGGAGGG + Intronic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978352697 4:107837070-107837092 ATTTCCAAAGGAATGGAGGAGGG - Intronic
978740123 4:112127526-112127548 CTTTAAAAAAAAAAGGATGAAGG + Intergenic
978833868 4:113123720-113123742 CTTTAAAAATATATGGATTATGG - Intronic
979024789 4:115555415-115555437 ATTTAAAAATAAATAGAGCAGGG - Intergenic
980464537 4:133155073-133155095 TTTTAAAAATAAACGTAGGAAGG + Intronic
982900219 4:160989489-160989511 CTTTAAAATTACATGGAAGAGGG - Intergenic
983768560 4:171518974-171518996 GTTTACAAATAAATCCATGAAGG + Intergenic
983864575 4:172749437-172749459 CTTCACACATAAATGGAGAGAGG - Intronic
986641355 5:9875156-9875178 GTTTGCAATCAAATGGAGGAGGG - Intergenic
988466669 5:31498339-31498361 TTTTACAAGTAAAAGGAAGATGG - Intronic
988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG + Exonic
989232690 5:39104062-39104084 CTATACCAATAAAGGCAGGAGGG + Intergenic
989782683 5:45288253-45288275 ATTTAAAAAGAAATGGAGGTAGG - Intronic
990014871 5:51047665-51047687 CTTTACAAAGAAATCAAGGGAGG - Intergenic
990640486 5:57778450-57778472 CTTTACAAATAAAGAGATGGAGG - Intergenic
990906370 5:60807554-60807576 CTTTACAAATAAACTGTGGGGGG + Intronic
991988970 5:72319058-72319080 CTTTTTAAAAAAATAGAGGATGG + Intronic
992376330 5:76191382-76191404 GTTTATAAATAAATGGTGCAAGG + Intronic
993390359 5:87313377-87313399 CTTTACCAAGAAAAAGAGGAAGG + Intronic
993477153 5:88379956-88379978 CTTTAAAAATAAAAGTAGGCTGG - Intergenic
993827095 5:92703672-92703694 TTTTACTAATATATGGATGAGGG + Intergenic
994072605 5:95619891-95619913 CTTTACACGTAAATAGAGAATGG + Intergenic
994138094 5:96310465-96310487 TTTTACAAAAAATTAGAGGAAGG - Intergenic
995129526 5:108615175-108615197 CCTTATAAATAAATGGACGTAGG - Intergenic
995300108 5:110570047-110570069 TTTTACAAGTAATAGGAGGAAGG + Intronic
996615309 5:125434373-125434395 CTTAAAAAAAAAGTGGAGGAGGG + Intergenic
996877531 5:128255730-128255752 TTTTAAAAAAAAATGGAGGCTGG + Intergenic
998104615 5:139460510-139460532 CTTTCTAGATAAATGCAGGAAGG - Intronic
998593570 5:143503444-143503466 TTTGCCAAATAAATGAAGGAAGG + Intergenic
998613430 5:143713916-143713938 CTTTAAAACTAAAGGAAGGAAGG + Intergenic
998876306 5:146603513-146603535 CTCCACAAATAAATGGTGGTAGG - Intronic
998876855 5:146608887-146608909 TGTTACAAAAAAATAGAGGAGGG + Intronic
999503551 5:152170856-152170878 CTTTTTCAATAAATGGATGAAGG - Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000466936 5:161590926-161590948 CTATTCAAAAAAATTGAGGAGGG - Intronic
1000992092 5:167921868-167921890 CTTTACAAATACAAAGATGAAGG + Intronic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003563676 6:7204334-7204356 CTATGCAAACAAATGGGGGATGG - Intronic
1003750711 6:9052163-9052185 ATTAACAAATAAAGGGAGGAGGG - Intergenic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1004493243 6:16138315-16138337 CTTTACAAAAAAAAAAAGGAGGG + Intronic
1004607889 6:17211017-17211039 CTTTAGAAATCAACGCAGGAAGG + Intergenic
1004634372 6:17452934-17452956 TTTTAAAAAAAAGTGGAGGAGGG + Intronic
1004753212 6:18584678-18584700 CTTTGCAAAAAAATGGGAGAGGG + Intergenic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1004928580 6:20439826-20439848 CTTAAGAAAAAATTGGAGGAGGG - Intronic
1004957548 6:20746546-20746568 CCTTACATAGTAATGGAGGAGGG - Intronic
1004959301 6:20768615-20768637 CATTACAACTGAATGGAGGAAGG - Intronic
1005055039 6:21721151-21721173 CTTTAATAATAAAAGGGGGAGGG - Intergenic
1005419103 6:25630854-25630876 CTTTACAAATAAGTGCAGTGAGG - Intergenic
1005521041 6:26601042-26601064 CTTTCCAAATAAGTTGAGGTGGG + Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1006229446 6:32570592-32570614 CTTGACAAATAAGTGGATGGTGG - Intronic
1006620514 6:35360777-35360799 CTCTAAAAATAAATCGGGGATGG - Intronic
1008138363 6:47803054-47803076 CTTTACAAGTTTATGGAGGAAGG + Intronic
1008455412 6:51705216-51705238 CTTGAAAAATCAAAGGAGGATGG + Intronic
1010038203 6:71351076-71351098 CTTTACATTTACATGGAGGCAGG - Intergenic
1010435988 6:75831601-75831623 CTTTAAAAATGTGTGGAGGATGG + Intronic
1010775845 6:79884494-79884516 CTATTCCAAAAAATGGAGGAGGG + Intergenic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1013447057 6:110240440-110240462 CTTTATAACTATATGGAGGCTGG - Intronic
1013769523 6:113612275-113612297 CTTTTTAAATAAATAGAGGCAGG + Intergenic
1013990439 6:116248795-116248817 CAATACAAAGAAATGGAGCAGGG + Exonic
1014357105 6:120426189-120426211 CCTTACAAAGCAATGGAGAAGGG + Intergenic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1020331181 7:7018426-7018448 GTTTACAATCAAAAGGAGGAGGG - Intergenic
1021465742 7:20941631-20941653 TTTTCCAAAAAAATGGAAGAGGG + Intergenic
1021546359 7:21817331-21817353 CTCTACATATAAAAAGAGGATGG - Intronic
1021614329 7:22487023-22487045 CTTTTCACATAGATAGAGGAAGG + Intronic
1022343528 7:29490629-29490651 CATTACAAATTAATGGGGGAAGG - Intronic
1022882276 7:34600527-34600549 CTTTTCAAATAAATTGATGATGG - Intergenic
1024298192 7:47863119-47863141 CTTTATAAGTGAATGGATGAGGG + Intronic
1024879393 7:54068552-54068574 CTTAAAAAATAAATAGAAGATGG + Intergenic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1028768411 7:94586796-94586818 ATTTAAAACTAAATGGAGGCTGG - Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1028965916 7:96800992-96801014 CTTTATAAATTGATGGAGGGAGG + Intergenic
1029316657 7:99721795-99721817 CTTGACAAATAAATCAAAGAAGG + Intronic
1030384849 7:108856289-108856311 CTTAACCAATAAATGAAAGAGGG - Intergenic
1030520100 7:110588100-110588122 TTTTACAAATGAGAGGAGGAAGG - Intergenic
1031385400 7:121143950-121143972 CATTAAAAATAAATGAAGTATGG + Intronic
1032349832 7:131150886-131150908 CTTTCAAAATAAATGAAGAAGGG + Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032607257 7:133369283-133369305 CTTTAAAAAGAAAAGGAGAAAGG - Intronic
1032837359 7:135686534-135686556 CTCTACAAATAAAAAGAGCAGGG - Intronic
1033314688 7:140287692-140287714 CTTCCCTAATAAATGGATGAAGG + Intergenic
1034082772 7:148295785-148295807 CTTTAAAAATTAATTGAGGCCGG - Intronic
1038157591 8:25004806-25004828 CTTGACAAATAATTGGGGGGTGG + Intergenic
1038911543 8:31970386-31970408 GGTTACAAATAAATGGTTGATGG + Intronic
1039939812 8:42080401-42080423 CTTTACAAAAGAAGGAAGGAAGG - Intergenic
1040778970 8:51083367-51083389 CTTGAAAAATAAATAGAGGCCGG - Intergenic
1041384678 8:57288414-57288436 CTTTAAAAATTCAAGGAGGAGGG - Intergenic
1042520784 8:69709142-69709164 CTTTGCATATAAAAGGAAGAAGG + Intronic
1042841965 8:73133019-73133041 CTTTAGAAATAACTGGATTAAGG + Intergenic
1042874671 8:73430119-73430141 ATTTTCAGAGAAATGGAGGAGGG - Intronic
1043104089 8:76085929-76085951 CTATATAAATACATGGAAGAAGG - Intergenic
1043240908 8:77934746-77934768 TTTTACAAATAAGTGAAGGGAGG + Intergenic
1043357838 8:79434596-79434618 CTTTACAAATATATAGTGTATGG - Intergenic
1044006471 8:86943084-86943106 CTTTTTAAATAAATGCAGGCTGG + Intronic
1044698204 8:94944066-94944088 AATTTAAAATAAATGGAGGAAGG - Intronic
1045160600 8:99539194-99539216 ATTTACAAATTAATGGTGAAAGG - Intronic
1045434653 8:102149903-102149925 CTTTGAAACTAAATGGTGGATGG + Intergenic
1046161669 8:110374931-110374953 GTTTACAAACTATTGGAGGAGGG - Intergenic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1047292936 8:123545569-123545591 TTTTACAAATAAAGGAAGTATGG - Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047849950 8:128845962-128845984 ATTTATAAATAAATGGTGGCTGG + Intergenic
1049350655 8:142162777-142162799 ATTGACAGATGAATGGAGGAGGG + Intergenic
1050225342 9:3448517-3448539 CTTTAAAAAAAAATAGAGAAGGG + Intronic
1050530694 9:6586469-6586491 CTTTACAAAGAAATTGAGGCTGG + Intronic
1051591686 9:18782587-18782609 ATTAACAAATGAATGGAGCAAGG + Intronic
1052484968 9:29085481-29085503 CTTTTCGAATAATTGGAGGAAGG - Intergenic
1055419702 9:76125864-76125886 CATTCCAAATAAAAGGAGAAAGG + Intronic
1055676830 9:78671842-78671864 CTTTTCAAATAATTGAATGATGG + Intergenic
1055744752 9:79430982-79431004 CTTTAAAAATAAATGACTGAGGG + Intergenic
1056162505 9:83910814-83910836 CTTTACAAATAGGCGTAGGAGGG + Intronic
1056357842 9:85820713-85820735 CTTTACAAATAGGCGTAGGAGGG - Intergenic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058909657 9:109509020-109509042 CTTTAAAAATAAATAGAGATGGG - Intergenic
1059067792 9:111103571-111103593 TTTTATAAATAAATGGATTAGGG - Intergenic
1062714639 9:138002246-138002268 CATTGGAAATCAATGGAGGAAGG + Intronic
1186392152 X:9171656-9171678 CCTTACAAATAAATGTACAATGG - Intergenic
1186439793 X:9575931-9575953 TTTTACCTTTAAATGGAGGAGGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187160883 X:16764266-16764288 CTTTACTTAAAAATGGAGGGGGG - Exonic
1187526904 X:20062478-20062500 CTTTAAAAAAAAAAGAAGGAAGG + Intronic
1188474223 X:30573363-30573385 CTTGCCAAATAAAAGAAGGAAGG + Intronic
1188573184 X:31614102-31614124 CTTTACAAATATTTGGAAAATGG - Intronic
1189914896 X:45847365-45847387 CTTAAAAAATAAATGGAAGCTGG - Intergenic
1190238917 X:48641500-48641522 ATTTAAAAATAAATGTAGGCCGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1192823307 X:74666991-74667013 CTTAAGAAATAAATGGATGAGGG - Intergenic
1192864067 X:75111297-75111319 CTTTTTAAATAAATGGATTATGG + Intronic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1194016897 X:88633785-88633807 TATTCCAAAAAAATGGAGGAAGG + Intergenic
1194109983 X:89821856-89821878 CTTATTAAATAAATGGAGCAGGG - Intergenic
1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG + Intronic
1196103244 X:111869523-111869545 ACTTAGAACTAAATGGAGGAAGG + Intronic
1196393159 X:115231041-115231063 ATTTCAAAATAAATGGGGGAAGG - Intronic
1197552132 X:127904257-127904279 CTATTCAAAAAAATTGAGGAGGG + Intergenic
1197621767 X:128758553-128758575 CTTTACCAAAAAAGGAAGGAAGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198589792 X:138165088-138165110 CTTTAAAAATAAATACAGGTGGG - Intergenic
1200503277 Y:3979362-3979384 CTATTCCAATAGATGGAGGAGGG - Intergenic