ID: 1153489568

View in Genome Browser
Species Human (GRCh38)
Location 18:5632944-5632966
Sequence GCATAGGCAAGAGGGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153489568_1153489574 8 Left 1153489568 18:5632944-5632966 CCAAATGCCCCTCTTGCCTATGC No data
Right 1153489574 18:5632975-5632997 TGATAAGAATCATTACCTTCAGG No data
1153489568_1153489575 13 Left 1153489568 18:5632944-5632966 CCAAATGCCCCTCTTGCCTATGC No data
Right 1153489575 18:5632980-5633002 AGAATCATTACCTTCAGGCCAGG No data
1153489568_1153489576 21 Left 1153489568 18:5632944-5632966 CCAAATGCCCCTCTTGCCTATGC No data
Right 1153489576 18:5632988-5633010 TACCTTCAGGCCAGGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153489568 Original CRISPR GCATAGGCAAGAGGGGCATT TGG (reversed) Intergenic
No off target data available for this crispr