ID: 1153500867

View in Genome Browser
Species Human (GRCh38)
Location 18:5748526-5748548
Sequence GTGTAGACCTAAACTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153500865_1153500867 -10 Left 1153500865 18:5748513-5748535 CCTTTTCCTTCATGTGTAGACCT No data
Right 1153500867 18:5748526-5748548 GTGTAGACCTAAACTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153500867 Original CRISPR GTGTAGACCTAAACTTTTAA AGG Intergenic
No off target data available for this crispr