ID: 1153501089

View in Genome Browser
Species Human (GRCh38)
Location 18:5750883-5750905
Sequence CTGCACTTCCAGATGATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153501085_1153501089 19 Left 1153501085 18:5750841-5750863 CCTGGCAGCCATCTTTTTATGAA No data
Right 1153501089 18:5750883-5750905 CTGCACTTCCAGATGATTAGAGG No data
1153501084_1153501089 30 Left 1153501084 18:5750830-5750852 CCAGTGAGTTTCCTGGCAGCCAT No data
Right 1153501089 18:5750883-5750905 CTGCACTTCCAGATGATTAGAGG No data
1153501086_1153501089 11 Left 1153501086 18:5750849-5750871 CCATCTTTTTATGAAAGAATAGA No data
Right 1153501089 18:5750883-5750905 CTGCACTTCCAGATGATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153501089 Original CRISPR CTGCACTTCCAGATGATTAG AGG Intergenic
No off target data available for this crispr