ID: 1153501321

View in Genome Browser
Species Human (GRCh38)
Location 18:5752761-5752783
Sequence CTTACCACCGATGAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153501316_1153501321 17 Left 1153501316 18:5752721-5752743 CCTGCCTCAATTTTTTGCTTATT No data
Right 1153501321 18:5752761-5752783 CTTACCACCGATGAGTTCTGGGG No data
1153501314_1153501321 26 Left 1153501314 18:5752712-5752734 CCTGTGATCCCTGCCTCAATTTT No data
Right 1153501321 18:5752761-5752783 CTTACCACCGATGAGTTCTGGGG No data
1153501315_1153501321 18 Left 1153501315 18:5752720-5752742 CCCTGCCTCAATTTTTTGCTTAT No data
Right 1153501321 18:5752761-5752783 CTTACCACCGATGAGTTCTGGGG No data
1153501317_1153501321 13 Left 1153501317 18:5752725-5752747 CCTCAATTTTTTGCTTATTCAAT No data
Right 1153501321 18:5752761-5752783 CTTACCACCGATGAGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153501321 Original CRISPR CTTACCACCGATGAGTTCTG GGG Intergenic
No off target data available for this crispr