ID: 1153504965

View in Genome Browser
Species Human (GRCh38)
Location 18:5787664-5787686
Sequence GTGGCACCCCATAAATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153504965_1153504972 22 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504972 18:5787709-5787731 TGATACTAGGCAGGCCCTCTTGG No data
1153504965_1153504971 13 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504971 18:5787700-5787722 GTTAATCTGTGATACTAGGCAGG No data
1153504965_1153504969 9 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504969 18:5787696-5787718 ACCTGTTAATCTGTGATACTAGG No data
1153504965_1153504974 28 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504974 18:5787715-5787737 TAGGCAGGCCCTCTTGGGACTGG No data
1153504965_1153504973 23 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504973 18:5787710-5787732 GATACTAGGCAGGCCCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153504965 Original CRISPR GTGGCACCCCATAAATTTGT GGG (reversed) Intergenic
No off target data available for this crispr