ID: 1153504969

View in Genome Browser
Species Human (GRCh38)
Location 18:5787696-5787718
Sequence ACCTGTTAATCTGTGATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153504966_1153504969 8 Left 1153504966 18:5787665-5787687 CCACAAATTTATGGGGTGCCACC No data
Right 1153504969 18:5787696-5787718 ACCTGTTAATCTGTGATACTAGG No data
1153504961_1153504969 19 Left 1153504961 18:5787654-5787676 CCTTCAGTAACCCACAAATTTAT No data
Right 1153504969 18:5787696-5787718 ACCTGTTAATCTGTGATACTAGG No data
1153504965_1153504969 9 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504969 18:5787696-5787718 ACCTGTTAATCTGTGATACTAGG No data
1153504967_1153504969 -10 Left 1153504967 18:5787683-5787705 CCACCAGTCACAGACCTGTTAAT No data
Right 1153504969 18:5787696-5787718 ACCTGTTAATCTGTGATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153504969 Original CRISPR ACCTGTTAATCTGTGATACT AGG Intergenic
No off target data available for this crispr