ID: 1153504972

View in Genome Browser
Species Human (GRCh38)
Location 18:5787709-5787731
Sequence TGATACTAGGCAGGCCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153504966_1153504972 21 Left 1153504966 18:5787665-5787687 CCACAAATTTATGGGGTGCCACC No data
Right 1153504972 18:5787709-5787731 TGATACTAGGCAGGCCCTCTTGG No data
1153504967_1153504972 3 Left 1153504967 18:5787683-5787705 CCACCAGTCACAGACCTGTTAAT No data
Right 1153504972 18:5787709-5787731 TGATACTAGGCAGGCCCTCTTGG No data
1153504965_1153504972 22 Left 1153504965 18:5787664-5787686 CCCACAAATTTATGGGGTGCCAC No data
Right 1153504972 18:5787709-5787731 TGATACTAGGCAGGCCCTCTTGG No data
1153504968_1153504972 0 Left 1153504968 18:5787686-5787708 CCAGTCACAGACCTGTTAATCTG No data
Right 1153504972 18:5787709-5787731 TGATACTAGGCAGGCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153504972 Original CRISPR TGATACTAGGCAGGCCCTCT TGG Intergenic
No off target data available for this crispr