ID: 1153504977

View in Genome Browser
Species Human (GRCh38)
Location 18:5787736-5787758
Sequence GGACTTTTCCAGCACTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153504968_1153504977 27 Left 1153504968 18:5787686-5787708 CCAGTCACAGACCTGTTAATCTG No data
Right 1153504977 18:5787736-5787758 GGACTTTTCCAGCACTACACAGG No data
1153504970_1153504977 16 Left 1153504970 18:5787697-5787719 CCTGTTAATCTGTGATACTAGGC No data
Right 1153504977 18:5787736-5787758 GGACTTTTCCAGCACTACACAGG No data
1153504975_1153504977 -10 Left 1153504975 18:5787723-5787745 CCCTCTTGGGACTGGACTTTTCC No data
Right 1153504977 18:5787736-5787758 GGACTTTTCCAGCACTACACAGG No data
1153504967_1153504977 30 Left 1153504967 18:5787683-5787705 CCACCAGTCACAGACCTGTTAAT No data
Right 1153504977 18:5787736-5787758 GGACTTTTCCAGCACTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153504977 Original CRISPR GGACTTTTCCAGCACTACAC AGG Intergenic
No off target data available for this crispr